Bioinformatics/Subsequence

From Rosetta Code
Bioinformatics/Subsequence is a draft programming task. It is not yet considered ready to be promoted as a complete task, for reasons that should be found in its talk page.
Task

Randomly generate a string of   200   DNA bases   (represented by   A,  C,  G,  and  T).

Write a routine to find all the positions of a randomly generated subsequence   (four letters).

11l[edit]

Translation of: Python
UInt32 seed = 34
F nonrandom_choice(lst)
   :seed = (1664525 * :seed + 1013904223) [&] FFFF'FFFF
   R lst[Int(:seed >> 16) % lst.len]

F generate_sequence(Int n)
   R ((0 .< n).map(_ -> nonrandom_choice([‘A’, ‘C’, ‘G’, ‘T’]))).join(‘’)

F positions(dnaSeq, subSeq)
   [Int] r
   V start = 0
   L
      V? pos = dnaSeq.find(subSeq, start)
      I pos == N
         L.break
      r.append(pos)
      start = pos + 1
   R r

F dna_findall(String needle, haystack) -> N
   V pp = positions(haystack, needle)
   I pp.empty
      print(‘No matches found’)
   E
      print(‘Found ’needle‘ at the following indices:’)
      L(p) pp
         print(p‘:’(p + needle.len))

V dna_seq = generate_sequence(200)
V sample_seq = generate_sequence(4)

V c = 1
L(i) dna_seq
   I c % 20 != 0 {print(i, end' ‘’)} E print(i)
   c++
print("\nSearch Sample: "sample_seq)

dna_findall(sample_seq, dna_seq)
Output:
GAAGTGCTCAAACCCTTTTT
CCTTGCCGTAGGTTGTGCTG
CCGCCGCACACCCGCAACAG
CTTTTAGGCATAAGTATACG
GACCGCGGACGGGGCGTAAC
GGTGAACATTTTGCTAAATT
GGCTCTAGGGATGAGCCCTA
TAGCGCTGGGGACTACGCCC
CGGTAAAGATCGAGGCGACT
CACCGATTGCGCTAGGGACA

Search Sample: CGTA
Found CGTA at the following indices:
26:30
94:98

Action![edit]

DEFINE SEQLEN="200"
DEFINE SUBLEN="4"

PROC RandomSeq(CHAR ARRAY s BYTE len)
  CHAR ARRAY letters="ACGT"
  BYTE i

  FOR i=1 TO len
  DO
    s(i)=letters(Rand(4)+1)
  OD
  s(0)=len
RETURN

PROC PrintSeq(CHAR ARRAY s)
  BYTE i

  FOR i=1 TO s(0)
  DO
    IF i MOD 20=1 THEN
      IF i<10 THEN Put(32) FI
      IF i<100 THEN Put(32) FI
      PrintB(i)
      Print(": ")
    FI
    Put(s(i))
    IF i MOD 20=0 THEN
      PutE()
    FI
  OD  
RETURN

BYTE FUNC StartsWith(CHAR ARRAY s,prefix BYTE start)
  BYTE i

  FOR i=1 TO prefix(0)
  DO
    IF s(start+i-1)#prefix(i) THEN
      RETURN (0)
    FI
  OD
RETURN (1)

PROC Main()
  CHAR ARRAY seq(SEQLEN+1),sub(SUBLEN+1)
  BYTE i,notfirst

  RandomSeq(seq,SEQLEN)
  RandomSeq(sub,SUBLEN)

  PrintE("Search sequence:")
  PrintSeq(seq)
  PutE()
  PrintF("Subsequence to find: %S%E%E",sub)

  PrintE("Found subsequence at positions:")
  notfirst=0
  FOR i=1 TO SEQLEN-SUBLEN
  DO
    IF StartsWith(seq,sub,i) THEN
      IF notfirst THEN
        Print(", ")
      FI
      notfirst=1
      PrintF("%I-%I",i,i+SUBLEN-1)
    FI
  OD
  IF notfirst=0 THEN
    PrintE("Not found")
  FI
RETURN
Output:

Screenshot from Atari 8-bit computer

Search sequence:
  1: CGACTCAGGAAGGCCACGTG
 21: GTAACTTCTTAGTTACCGTA
 41: AGGCTAATAGCTAGCGCTGC
 61: GTGACCAGGCATAGTAACCG
 81: GCACGCACGTTCACCAAGGG
101: GTCCCGATGGGAGGCACGTT
121: ACTACTCCAAGAACTGTAGT
141: AAGTTACCGAAAAGTTCTCA
161: TCCTTGGGTAGTGAGTACTT
181: TGTGCTATGAAAAATAAGGA

Subsequence to find: ACGC

Found subsequence at positions:
83-86

Ada[edit]

with Ada.Text_Io;
with Ada.Strings.Fixed;
with Ada.Numerics.Discrete_Random;

procedure Sub_Sequence is

   type Nucleotide is (A, C, G, T);

   function To_Character (N : Nucleotide) return Character
   is (case N is
          when A => 'A', when C => 'C',
          when G => 'G', when T => 'T');

   package Random_Nucleotide is new Ada.Numerics.Discrete_Random (Nucleotide);
   use Random_Nucleotide;

   package Position_Io is new Ada.Text_Io.Integer_Io (Natural);
   use Ada.Text_Io;

   procedure Put_Bases (Seq : String; Width : Positive) is
      First : Natural := Seq'First;
   begin
      while First < Seq'Last loop
         declare
            Last : constant Natural :=
              Natural'Min (First + Width - 1, Seq'Last);
         begin
            Position_Io.Put (First); Put ("..");
            Position_Io.Put (Last);  Put (" ");
            Put (Seq (First .. Last));
            New_Line;
            First := Last + 1;
         end;
      end loop;
   end Put_Bases;

   Gen       : Generator;
   Sequence  : String (1 .. 405);
   Substring : String (1 ..   4);
   Pos       : Natural := 0;
begin
   Position_Io.Default_Width := 3;

   Reset (Gen);

   Sequence  := (others => To_Character (Random (Gen)));
   Substring := (others => To_Character (Random (Gen)));

   Put_Line ("Search sequence:");
   Put_Bases (Sequence, Width => 50);
   New_Line;

   Put ("Substring to search: ");
   Put (Substring);
   New_Line;

   loop
      Pos := Ada.Strings.Fixed.Index (Sequence, Substring, Pos + 1);
      exit when Pos = 0;
      Put ("Found at position: ");
      Position_Io.Put (Pos); Put ("..");
      Position_Io.Put (Pos + Substring'Length - 1);
      New_Line;
   end loop;
end Sub_Sequence;
Output:
Search sequence:
  1.. 50 CCTACGGAAAAGTGATAAGGACAGATACATAATCCTAAAACCCTGGAAAA
 51..100 CTTGTCTCGCCAGAGTAGGGCTCGGCAGGGGGGGCAGTGTTTTAAAACGT
101..150 CAGAGAATAGGCTCTACCTTGTTAGACTGCGAGTACTGGAGCGTAGTTCC
151..200 TATATTGCAAGCTGCTACAGTAAGTATCAAAGTATGCCACACATCCTTCT
201..250 ACAACCGGATTGGTTGCCCAGTAGAAGGCTCGTAGTCACCGGACACGCTG
251..300 TTCTTAAGGTCGGTAAGCTATTACGTCCATGGGAGATTCTCAAGGGTGCG
301..350 TTAGCGGACCCCCGTTACGTCCACGTATCTTCCGTCCAACTACCCCCTAA
351..400 TGTCATTGACATCGCCCGAGTATTTAATTTATTTGAACGGCACCAATTTA
401..405 GAGCT

Substring to search: TATT
Found at position: 153..156
Found at position: 269..272
Found at position: 371..374
Found at position: 380..383

Arturo[edit]

bases: [`A` `G` `C` `T`]
randSeq: join map 1..200 => [sample bases]
randSub: join map 1..4 => [sample bases]

idx: 0

print "Random sequence:"
print join.with:"\n" split.every: 20 randSeq
print ""

print "Looking for subsequence:"
print randSub
print ""

while [(size randSeq) > idx + 4][
    if prefix? slice randSeq idx idx+4 randSub ->
        print ["Found subsequence at position:" idx]
    idx: idx + 1
]
Output:
Random sequence:
CACGCGCGTTAACCCTGCAT
CTTTTCTCTAAGATGATGCG
CTACTCTGCCCGATTACTAT
GATGTCACCGGCGGTTCGGC
GACTGGCGCTGGCAGAAAGC
GCATGTCAAATTGCCCCAGT
GTGCAAGTCCAAGTATTAGT
GAGGTGCTCCGCTTCGTCCG
GGGTCGACTCGGTCCCACTT
CATTACATGTTGGTAATAGT

Looking for subsequence:
CGGT

Found subsequence at position: 71 
Found subsequence at position: 169

Factor[edit]

Works with: Factor version 0.99 2021-02-05
USING: accessors formatting grouping io kernel math
math.functions.integer-logs math.parser random regexp sequences ;

: new-dna ( n -- str ) [ "ACGT" random ] "" replicate-as ;

: pad ( n d -- str ) [ number>string ] dip 32 pad-head ;

:: .dna ( seq n -- )
    seq length integer-log10 1 + :> d seq n group
    [ n * d pad write ": " write write nl ] each-index ;

: .match ( slice -- ) [ from>> ] [ to>> ] bi "%d..%d\n" printf ;

: .matches ( slices -- )
    "Matches found at the following indices:" print
    [ .match ] each ;

: .locate ( slices -- )
    [ "No matches found." print ] [ .matches ] if-empty ;

: .biosub ( dna-size row-size -- )
    [ new-dna dup ] [ .dna nl ] bi*
    4 new-dna dup "Subsequence to locate: %s\n" printf
    <regexp> all-matching-slices .locate ;

80 10 .biosub nl
600 39 .biosub nl
Output:
 0: ATTCAAGGAC
10: CACTATTAAC
20: CTGCATTGTG
30: AGAACTTGCA
40: GTGTACCGAG
50: AGCGAGTTTA
60: AAGCAACACA
70: TCTTTACCGA

Subsequence to locate: GTAG
No matches found.

  0: GATCTCGTCATGGTCCATCCTAACATTTCGGTTGTGGGC
 39: GCATCCCGATAGGCGAAGTTAAATCTACGTAGTCCTACG
 78: TCACGACGGAACATGATTGCCCACCGAAGTCGTAGGCGA
117: GCTAAAGTCGGTACATACACGATCTGCTATATTCGTTCT
156: CCGACACACGACATGCAATCCGAGAAGCTCTCGAAGTGC
195: GGTCAGATCCTCAGACTCGAACAGAGGAGACCTTAACTG
234: ATACCCACAGTACTTCTCGCATAACCTAAGCACCTATGC
273: TTACACCATCGTCCTGATATTGAGTGAGTCTGGTCGGAG
312: ATATTATCTAGCACCCTCAAGCTCTGTGTGCCACACCAG
351: GATTCCACTTCGCGCTTGCCTAGAGAAAGTAGAGTAGGT
390: GGTGTCATTAGTACACTGTTTGCGATGCACCAACCAAAC
429: CCGACCGCCATGATGACTGCTTTTCGGCCAACGTCAGAT
468: TAAGAGTACTTTTAGTAGCACCGCAAGCCAGCCGGTTTA
507: GCAAGATCCTGCAGCCTCCACGTTATTTCAGGTCTCTAA
546: GCGTTCTTTCCATGGAAGTAGTCACCGCTCCCGTTGCCA
585: ATGGACACAGACGTT

Subsequence to locate: ATAT
Matches found at the following indices:
145..149
289..293
312..316

Go[edit]

Translation of: Wren
package main

import (
    "fmt"
    "math/rand"
    "regexp"
    "time"
)

const base = "ACGT"

func findDnaSubsequence(dnaSize, chunkSize int) {
    dnaSeq := make([]byte, dnaSize)
    for i := 0; i < dnaSize; i++ {
        dnaSeq[i] = base[rand.Intn(4)]
    }
    dnaStr := string(dnaSeq)
    dnaSubseq := make([]byte, 4)
    for i := 0; i < 4; i++ {
        dnaSubseq[i] = base[rand.Intn(4)]
    }
    dnaSubstr := string(dnaSubseq)
    fmt.Println("DNA sequnence:")
    for i := chunkSize; i <= len(dnaStr); i += chunkSize {
        start := i - chunkSize
        fmt.Printf("%3d..%3d: %s\n", start+1, i, dnaStr[start:i])
    }
    fmt.Println("\nSubsequence to locate:", dnaSubstr)
    var r = regexp.MustCompile(dnaSubstr)
    var matches = r.FindAllStringIndex(dnaStr, -1)
    if len(matches) == 0 {
        fmt.Println("No matches found.")
    } else {
        fmt.Println("Matches found at the following indices:")
        for _, m := range matches {
            fmt.Printf("%3d..%-3d\n", m[0]+1, m[1])
        }
    }
}

func main() {
    rand.Seed(time.Now().UnixNano())
    findDnaSubsequence(200, 20)
    fmt.Println()
    findDnaSubsequence(600, 40)
}
Output:

Sample run:

DNA sequnence:
  1.. 20: GTTGCCCACACGTCTTATTG
 21.. 40: TAAAAATCACCGTGCAGCGA
 41.. 60: GGTTAAAAATGGTAGGAAAA
 61.. 80: TATCCTCAGCCAGCGGTGCC
 81..100: GGCCAACAAAAGGGACGTTG
101..120: GATTAAAGTAGGTCTAGGTA
121..140: TCTCGTATCCGGTTGATCCG
141..160: GGATGGTGGACGATATTGGA
161..180: GACCGGAGTGTACATCGGTG
181..200: TTGTCGCTTGCAGCTACGGT

Subsequence to locate: AATA
Matches found at the following indices:
 59..62 

DNA sequnence:
  1.. 40: GTACAGCCACTGTTAGTAGACGGATGCTATTGGGACGCAA
 41.. 80: CACATCAGTACACTGCTTGTTCGTAATCGCGTACCCAGCG
 81..120: CAAAAGGAGGGGAGGAACCTGCTCAGACTGTCGCTAAAAA
121..160: CGAGCACGTGTCCTTACGCAGTGATGGTAGCGGTCCACGA
161..200: CTTCCACTGGCATAAGGAGAATGTTTAGTAACGCCCCTCA
201..240: TAGGTGCAATTCTACAGGTTAAGGGACCGTGGGATGTTTC
241..280: TATAAAAGTTGAAGAGATTACTAATCCGTCCCGTGCGCGT
281..320: GCCGCAATTTAGCGCCCGTTCTTGAGTAAACATACATGCA
321..360: CGCTCTTGAGTTTTCTAAAACCTGATCAAAACGGTCGCCC
361..400: ACATGCAGGAGCGCCGCAGGGTTTCAGAGGTCAACCATCG
401..440: GCAGCACACGTGAACCCTCTGTACTGACCAGGGGCTTGCT
441..480: CCTTGGTAGGAGATGGTGGAGAATGCGTCGATGCACTGAA
481..520: GCAGACCGCTGATAGCATGTACGATGTTTACGGGTTGACG
521..560: ATAGCTTTGCTAGTGATCGAACATATGATGAAAAACGCTT
561..600: CCATTGATAGAGCATCTTAGGAGCTCAGTCCAGTGACCTC

Subsequence to locate: AGGT
Matches found at the following indices:
202..205
216..219
388..391

jq[edit]

Works with: jq

Works with gojq, the Go implementation of jq

Neither jq nor gojq currently has any PRNG built-ins so one possibility is to use a jq-coded PRNG function such as can be found at https://rosettacode.org/wiki/Random_numbers#jq

In practice, it's usually more convenient to use a utility such as gshuf or jot to provide the source of randomness. Here we use `jot -r N MIN MAX` but a fourth argument can also be used to specify a seed. An alternative would be to use `gshuf` along the lines of:

# For 200 pseudo-random integers in the range 0 to 3 inclusive:
gshuf -i 0-3 -r -n 200 --random-source=/dev/random

Note that the indices shown below are offsets (i.e., the index origin is taken to be 0).

#!/bin/bash

jot -r 200 0 3 | jq -nr --slurpfile four <(jot -r 4 0 3) '

 # input: an array of integers
 def toDNA: 
   def base: . as $in | "ACGT" | .[$in : $in+1];
   map(base) | join("");

 ([inputs] | toDNA) as $strand
 | ($four  | toDNA) as $four
 | "Strand of length \($strand|length):",
   $strand,
   "Zero-based indices of \($four):",
   ($strand | indices($four) | join(" "))
'
Output:
./bioinformatics-subsequence.sh
Strand of length 200:
TGGGCCCAAGCATTGCCACGTAGCTTTGTCAGTGGGCTTGTAAGGGACGAACACAAACTCACAGACCAGGAATTCTCGAGTTCCAGTCCCCCCACTTGTCGCTATTTAGTTAAGACGTTCAGTTTCGTTGCGAACTGTGTCCCCCAGGCTAACGTGATGGGTGTCAGGAATCAATGGCCAACTTTCAGTTAGACTTGACC
Zero-based indices of CAAC:
178

./bioinformatics-subsequence.sh
Strand of length 200:
TAAGACTGCAGGGTACGAAGAGTGGAAGATTGGCTCGTACTTGTCGACGTCGCGTGACATAATCTCTGTGCTCGCCTCGCAGTAAGGGACTAGGTCCCGTTCGAGCGCCCTGCTAGAAGGAGCATCCTACCATGCTCTGATGACATCCTGTCGGCATTAGAGTTTCTACGACATCTAAAGAGTACGATCGACTTCCCAGT
Zero-based indices of GACA:
55 141 169

Julia[edit]

DNArand(n, bases=['A', 'T', 'C', 'G']) = String(rand(bases, n))

DNAsearch(needle, haystack, lap=true) =  findall(needle, haystack, overlap=lap)

const rand_string = DNArand(200)
const subseq = DNArand(4)

println("Search sequence:\n$rand_string\nfor substring $subseq. Found at positions: ")
foreach(p -> print(rpad(p[2], 8), p[1] % 10 == 0 ? "\n" : ""), enumerate(DNAsearch(subseq, rand_string)))
Output:
Search sequence:
CCGAAGCCAGGAGGACTGAGCGCTTGCGTCCCGAGTTCTGCGACGAGTCTCTTCATTATAAGGCCACTGATTGCGCTCATCATGAGTGCCAGAAGCACCGCTAAACATAAGTGTCCTTTCTTCCTGACGCACTTGAAGATTGTGACCATTTGTGCGGGTTGTGAGTTAGGGGCTCTCATTGTACACGATCTATAGTGTGC
for substring CGCT. Found at positions:
21:24   74:77   99:102

Nim[edit]

import random, sequtils, strutils

proc dnaSequence(n: Positive): string =
  ## Create a random DNA sequence of length "n".
  newSeqWith(n, sample("ACGT")).join()

proc positions(dnaSeq, subSeq: string): seq[int] =
  ## Return the list of starting positions of a subsequence
  ## "subSeq" in a sequence "dnaSeq". Positions start at 1.
  var start = 0
  while true:
    let pos = dnaSeq.find(subSeq, start)
    if pos < 0: break
    result.add pos + 1
    start = pos + 1


when isMainModule:

  const
    N = 200
    Step = 20

  randomize()

  let dnaSeq = dnaSequence(N)
  echo "DNA sequence:"
  for i in countup(0, N - 1, Step):
    echo ($(i+1)).align(3), ' ', dnaSeq[i..i+(Step-1)]

  let subSeq = dnaSequence(3)
  echo "\nDNA subsequence: ", subSeq

  echo()
  let pos = dnaSeq.positions(subSeq)
  if pos.len == 0:
    echo "Subsequence not found."
  else:
    let tail = if pos.len == 1: ": " else: "s: "
    echo "Subsequence found at position", tail, pos.join(", ")
Output:
DNA sequence:
  1 CACATACGATGAGCTGGGCG
 21 CCTAAGAGGCGGAAAGACAA
 41 CCGTGTGTGTCTAACCCATG
 61 GTTTAATTGCAGATAGTCTC
 81 TAGACTACAAACATTAGAGC
101 AATGCACCGGGGTGCACGTG
121 TGTTTTGACTTCCCATGAAA
141 GCCCTTATCCTAGAGTACAG
161 TCGGCAAATGTTCGCTCCTT
181 GGCCCACTCCATTTGGACGG

DNA subsequence: GTT

Subsequence found at positions: 61, 122, 170

Perl[edit]

use strict;
use warnings;
use feature 'say';

my @bases = <A C G T>;
my $basecnt = 160;

my($string,$target);
$string .= $bases[ int rand @bases ] for 1 .. $basecnt;
$target .= $bases[ int rand @bases ] for 1 .. 4;
say "Target: $target";
say 'Matches at these positions:';
say (($string =~ s/.{1,40}\K/\n/gr) =~ s/($target)/ >$1< /gr);
Output:
Target: CCTG
Matches at these positions:
9
90
157
TTGCC >CCTG< CAAAGTTAATAAGTAAACAATTAAGTGAGTG
CTCTAGGGTAAGGTGAGGGCGGGAAGGGGAAAAATACCGA
TGCGAG >CCTG< TAGAGCCGGGCCTCAAATTAAACGAAAAAT
ATAAGTTTGCTTGGCACGCTGTACTACTTATCC >CCTG< ACT

Phix[edit]

Currently only searches for non-overlapped sequences, but it should be pretty obvious how to change that, in which case the next underline will simply partially overwrite the previous, so you'll get eg "<=<==>".

with javascript_semantics

constant cheat = false

function grandna(integer len)
    string dna = repeat(' ',len)
    for i=1 to len do dna[i] = "ACGT"[rand(4)] end for
    return dna
end function

procedure show(string dna, test, sequence idx)
    idx = deep_copy(idx) & length(dna)+100 -- (add an otherwise unused sentinel)
    sequence s = split(trim(join_by(split(join_by(dna,1,10,""),"\n"),1,5," ")),"\n")
    integer ii = 1,         -- idx index
            i = idx[ii],    -- current target
            ux = 1,         -- underline index (1..4)
            ldx = 1         -- line index (1, 51, 101, etc)
    for si=1 to length(s) do
        printf(1,"%3d: %s\n",{ldx,s[si]})
        ldx += 50
        if i and i<ldx then
            string ul = repeat(' ',59)
            while i and i<ldx do
                integer up = i-ldx+51       -- underline pos (relative to ldx)
                up += floor((up-1)/10)+5    -- (plus any needed spacing)
                ul[up] = "<==>"[ux]
                ux += 1
                i += 1
                if ux>4 then
                    ux = 1
                    ii += 1
                    i = idx[ii]
                end if
            end while
            printf(1,"%s\n",ul)
        end if
    end for
    if length(idx)>1 then
        string p = iff(length(idx)>1?"s":""),
               t = join(apply(idx[1..$-1],sprint),", ")
        printf(1,"%s occurs at location%s: %s\n",{test,p,t})
    else
        printf(1,"%s does not occur\n",{test})
    end if
end procedure

string dna = grandna(200),
       test = grandna(4)
constant cheats = iff(cheat?{9,13,49,60,64,68}:{})
for i=1 to length(cheats) do
    dna[cheats[i]..cheats[i]+3] = test
end for
sequence idx = match_all(test,dna)
show(dna,test,idx)
Output:

with cheat enabled

  1: GGAGATATCG ACCGACCGAA GTAAAGTCAA AGTCGTCCAA TCCACGGACG
             <= =><==>                                   <=
 51: ACTTCAGCAC GACCGACCGA CCTATTTAAG AGACCACACT TAAGGAATCC
     =>       < ==><==><== >
101: ATGCGAAATA AAAATGGGCG AGTAGCCGTG GGGCGCTAAA GCACCCACCT
151: AGTTTTCGCC GAAGTACTAG ACCACCTTCG GATCGACAAA GCTTTCACCA
                                         <==>
CGAC occurs at locations: 9, 13, 49, 60, 64, 68, 184

with cheat disabled

  1: TGATTTAAAC CGTGGTGCAA TTTATAAACA CTGCGATATG CCTCCTGATG
 51: GCATGGTATT CGACACCAAG ACGCTGGTGG GCACACTGGC TTTCAGAATA
101: GGAGTCACAA TCCCTCTATG ATGTCCTCTA GCGGGTGTGT GTTCAGTGCC
151: AGCGCTTACT TCCGGCGTGG CCGACTCTTT TTAAAGCGTA TAGCTGGGGT
GCTA does not occur

Python[edit]

Works with: Python version 3.8
Library: regex
 
from random import choice
import regex as re 
import time

def generate_sequence(n: int ) -> str:
    return "".join([ choice(['A','C','G','T']) for _ in range(n) ])

def dna_findall(needle: str, haystack: str) -> None:

    if sum(1 for _ in re.finditer(needle, haystack, overlapped=True)) == 0:
        print("No matches found")
    else:
        print(f"Found {needle} at the following indices: ")
        for match in re.finditer(needle, haystack, overlapped=True):
            print(f"{match.start()}:{match.end()} ")

dna_seq = generate_sequence(200)
sample_seq = generate_sequence(4)

c = 1
for i in dna_seq:
    print(i, end="") if c % 20 != 0 else print(f"{i}")
    c += 1
print(f"\nSearch Sample: {sample_seq}")

dna_findall(sample_seq, dna_seq)
Output:
TTGCCCCTGTACTGAGCCCA
TAAGCTTGCACTCAAGGTTT
TGCCCCCTCATATTATAACG
CATCCATTATACAAAACCGA
TACCCTTCCGCATATTATGA
AAAGTGGCGAAGTGCCTTGA
TTTGCATTCATAGTACAACG
GTGCAAAAGCATTGTATGTC
TCACATTTACATGGGAAATG
CCTAGTAGGTGCAAGACCTG

Search Sample: TACA
Found TACA at the following indices:
69:73
133:137
167:171

Racket[edit]

#lang racket

(define (rand-seq n)
  (build-string n (lambda _ (string-ref "TGAC" (random 4)))))

(define (subsequence-indices full part)
  (let ((part-length (string-length part)) (full-length (string-length full)))
    (for/list ((i (- full-length part-length))
               #:when (for/and ((p part) (f (in-string full i))) (eq? p f)))
      (cons i (+ i part-length -1)))))

(define (report-sequence s (l 50))
  (string-join (for/list ((i (in-range 0 (string-length s) l)))
                 (format "~a: ~a" (~a #:width 4 i)
                         (substring s i (min (string-length s) (+ i l)))))
               "\n"))
  
(define (Bioinformatics/Subsequence (full (rand-seq 400)) (sub (rand-seq 4)))
  (printf "Indices of ~a in~%~a~%~a~%"
          sub (report-sequence full) (subsequence-indices full sub)))

(module+ main (for ((i 4)) (Bioinformatics/Subsequence)))
Output:
Indices of TTAC in
0   : TTATCCTACCGCGTAAGTTCAATGCTCACCGCAGTTTGCTAACCGTTCCT
50  : AAATTCACTTCCTAAGGTATCTTTCGCTTAATTGATGCCGATTGAATTCC
100 : ACGGAGGGCGTAATTGTTTCGGACTTTAGACCTGACATAAGGGCACACTA
150 : GTCCTATTGAATTTGGTGCTATTCGGCGACCTACTAACCTTAGTCAGTGA
200 : AGAGCCATCTCAAAAGTACAGTCATCCTCAAGTGTTACATACGGCACCAT
250 : GACAGTGTATAAGCATGGAGGTTGGCCTATCGTCATATCGAGGCGGCGCC
300 : ATAGACCGGCCAGGTGATGAGATCGACTTTAATGTTGTTGCTTAGCTTGA
350 : CCTCTAGTTTGGATTAAGACGGTCATAGATAGATAGACCGTAAAGTATTC
((234 . 237))
Indices of GTAA in
0   : GTCAGTCCACGCAAGAATAGCAGTTGAGTGGACAATTTATGAGACGGAGA
50  : TAAGTAACCCGCTCCGAGATAAACGTCAGCCGGATTCCGCTGAGTCGGTC
100 : GCCTTCCAAGTGGCAGCTTGTTTGCATTGCTTACAGTGACTTGAACGATC
150 : ACCTACTCGAGGACTCTGCGGGTATTCCAGTTGCCTTGCACTCAGCGATG
200 : CACAAACTTTAAATTATCACAGAAAGAATGTGATTCGGGTGGTCACCCTT
250 : ATCGGTGAAACCAGTCCTTCCATGGGCATATTCTGCGTCGAAATGAGCCC
300 : GCTGTTTACGTTGTACGAACTGGGGACCTAAGGAAACGGGCCGTTCTTAG
350 : GTGATGTCAGCTGCAACGAACTACTGTTAACCTTCTCGATCTGTTGAAAA
((53 . 56))
Indices of AACG in
0   : TTTACAGTACGATTCCGAAGACACAAGAATGCGCCGGCTGTGGGTAGGGG
50  : CGACCCTGCGCGACCTATAAAAGGGGCGACTCAATTTTAGGCCCACCACG
100 : GACCCAGCCCTGTGCACAGAGCGGGGCATTTTTACCTCGCGTGCGCACCA
150 : ACTGCGATCTGCCTTGTCACATAATCCCACATACGAGTTGTATCTCTAAG
200 : AAGGGATGAGGCCAATTTAAATCCGGGTGCATTTCTCGGGGGGAGACACC
250 : AATGAGAGTGGGGCAAGGTGGCGTAGAGAGCTAATCGGGTTTTATGACCG
300 : CGGAAGACCTGGGATACGTCTGGGTGATAACTGAGGGCAGGTCAACGAAC
350 : CCTGATGCGTAGCCACGTCTCAGCTATCGGGCCTGTTTTCATAGTCCATG
((343 . 346))
Indices of CAGC in
0   : TGTGAACCACTATGACACGCTACACGCCTCAAGTTGGCCCCCATATAAGA
50  : ATATCCATCGGTTAATGTGTCTCGCGGCCGTTAGAACAAGCACTAAAGTT
100 : AGAGAAACCAACCATTGGACTAGATCAACATCAACGTCGCTGATAATAAA
150 : TGTATATCTGATGTGGCCGTTCATAAAATCGTTAACTACAGGTATCAACA
200 : TAGTCTCCCAACTTATATAATTGGTTAACTTAGGAGGAGCTTGCACAGCT
250 : CAGCTATATGCTATCTGGCCCTGGGCTTGGTAGGCATCACGTCGTTATGC
300 : TGCGAACATCTCAAAGACAAACGTTGATCCAGCCCCTAGAGAGGTCATTA
350 : GGCCTCGACCCAATTTAACCTCCCACTCCGTGGGTACAGCTTGAACCCCC
((245 . 248) (250 . 253) (329 . 332) (386 . 389))

Raku[edit]

Chances are actually pretty small that a random 4 codon string will show up at all in a random 200 codon sequence. Bump up the sequence size to get a reasonable chance of multiple matches.

use String::Splice:ver<0.0.3>;

my $line = 80;

my $haystack = [~] <A C G T>.roll($line * 8);

say 'Needle: ' ~ my $needle = [~] <A C G T>.roll(4);

my $these = $haystack ~~ m:g/<$needle>/;

my @match = $these.map: { .from, .pos }

printf "From: %3s to %3s\n", |$_ for @match;

my $disp = $haystack.comb.batch($line)».join.join("\n");

for @match.reverse {
    $disp.=&splice(.[1] + .[1] div $line, "\e[0m" );
    $disp.=&splice(.[0] + .[0] div $line, "\e[31m");
}

say $disp;
Output:

Show in custom div to better display highlighting.

Needle: TAGC
From: 159 to 163
From: 262 to 266
From: 315 to 319
From: 505 to 509
From: 632 to 636
CATATGTGACACTGACAGCTCGCGCGAAAATCCGTGTGACGGTCTGAACACTATACTATAGGCCCGGTCGGCATTTGTGG
CTCCCCAGTGGAGAGACCACTCGTCAATTGCTGACGACTTAACACAAATCGAGTCGCCCTTAGTGCCAGACGGGACTCCT
AGCAAAGGGCGGCACGTGGTGACTCCCAATATGTGAGCATGCCATCTAATTGATCTGGGGGGTTTCGCGGGAATACCTAG
GGGCGTTCTGTCCATGGATCTCTAGCCCTGCGAAGAGATACCCGCAGTGAGTTGCACGTGCAAAGAACTTGTAACTAGCG
TATTCTGTATCCGCCGCGCGATATGCTTCTGCGGGATGTACTTCTTGTGACTAAGACTTTGTTATCCAAATTGACCAATA
TTCAACGGTCGACTCTCCGAGGCAGTATCGGTACGCCGAAAAATGGTTACTTCGGCCATACGTAACCTCTCAAGTCACGA
TTACAGCCCACGGGGGCTTACAGCATAGCTCCAAAGACATTCCAATTGAGCTACAACGTGTTCAGTGCGGAGCAGTATCC
AGTACTCGACTGTTATGGTAAAAGGGCATCGTGATCGTTTATATTAATCATTGGGACAGGTGGTTAATGTCATAGCTTAG

REXX[edit]

This REXX version allows the user to specify:

  •   length of the (random) DNA data sequence     (default is 200).
  •   length of the (random) DNA sequence             (default is four).
  •   DNA proteins to be used in the sequence         (default is ACGT).
  •   width of the output lines of (random DNA)         (default is 100).
  •   often (if ever) to add a blank to the output       (default is every 10 proteins).
  •   DNA proteins to be searched in the data         (the default is four unique random proteins).
  •   the seed for the RANDOM function so runs can be repeated with the same data     (no default).
/*REXX pgm gens random DNA (ACGT) sequence & finds positions of a random 4─protein seq. */
parse arg totLen rndLen basePr oWidth Bevery rndDNA seed .
if totLen=='' | totLen==","  then totLen=   200  /*Not specified?  Then use the default.*/
if rndLen=='' | rndLen==","  then rndLen=     4  /* "      "         "   "   "     "    */
if basePr=='' | basePr==","  then basePr= 'acgt' /* "      "         "   "   "     "    */
if oWidth=='' | oWidth==","  then oWidth=   100  /* "      "         "   "   "     "    */
if Bevery=='' | Bevery==","  then Bevery=    10  /* "      "         "   "   "     "    */
if rndDNA=='' | rndDNA==","  then rndDNA=  copies(., rndLen)    /*what we're looking for*/
if datatype(seed, 'W')  then call random ,,seed  /*used to generate repeatable random #s*/
call genRnd                                      /*gen  data field of random proteins.  */
call show                                        /*show   "    "    "    "      "       */
say '  base DNA proteins used: '  basePr
say 'random DNA proteins used: '  dna?
call findRnd
if @=='' then do;  say "the random DNA proteins weren't found.";  exit 4;  end
say 'the random DNA proteins were found in positions:'     strip(@)
exit 0                                           /*stick a fork in it,  we're all done. */
/*──────────────────────────────────────────────────────────────────────────────────────*/
commas: parse arg ?;  do jc=length(?)-3  to 1  by -3; ?=insert(',', ?, jc); end;  return ?
/*──────────────────────────────────────────────────────────────────────────────────────*/
findRnd: @=;           p=0                       /*@:  list of the found target proteins*/
              do until p==0;    p= pos(dna?, $$, p+1);     if p>0  then @= @ commas(p)
   /*Found one?  Append it to the "Found"s*/
              end   /*p*/;             return
/*──────────────────────────────────────────────────────────────────────────────────────*/
genRnd: dna?=;        use= basePr;     upper use basePr rndDNA;       lenB= length(basePr)
              do k=1  for rndLEN;      x= substr(rndDNA, k, 1)
              if x==.  then  do;  ?= random(1, length(use) );         x= substr(use, ?, 1)
                                  use= delstr(use, ?, 1)   /*elide so no protein repeats*/
                             end
              dna?= dna? || x                              /*build a random protein seq.*/
              end   /*k*/
        return
/*──────────────────────────────────────────────────────────────────────────────────────*/
show: say " index │"center('DNA sequence of ' commas(totLen)  " proteins", oWidth+10)
      say "───────┼"center(''                                            , oWidth+10, '─')
      $=; $$=;                 idx= 1               /*gen data field of random proteins.*/
         do j=1  for totLen;   c= substr( basePr, random(1, lenB), 1)
          $$= $$ || c                                       /*append a random protein.  */
          if Bevery\==0  then if j//Bevery==0  then $= $' ' /*possibly add a blank.     */
          if length( space($ || c, 0) )<oWidth  then do;   $= $  ||  c;   iterate;   end
          say strip( right(idx, 7)'│' $, 'T');  $=          /*display line ──► terminal.*/
          idx= idx + oWidth                                 /*bump the index number.    */
          end   /*j*/
      if $\==''  then say right(idx, 7)"│" strip($, 'T')    /*show residual protein data*/
      say "───────┴"center(''                                            , oWidth+10, '─')
      say;                return
output   when using the default inputs:
 index │                                                 DNA sequence of  200  proteins
───────┼──────────────────────────────────────────────────────────────────────────────────────────────────────────────
      1│ TTTTTAGCG CGTTTTGTAG CGCTCTAAAA ACCGTAGCTA TATTTCTCGA AGTTTCACCC AGCTCTTTTG CCCCAGGGTT GCGCTAAGCC CAGCTTCGAG
    101│ GGGGCACAG GTAAAATACT ACCGTCCGTG GAGGGGGATG AATTGACCCG ACATTTTTTG AAGCATAACT CGTGACTCAA TATTGCATGA TTACACCAGC
───────┴──────────────────────────────────────────────────────────────────────────────────────────────────────────────

  base DNA proteins used:  ACGT
random DNA proteins used:  GCAT

the random DNA proteins were found in positions: 162 184
output   when using the inputs of:     1000   ,   ,   ,   ,   tttt
 index │                                       DNA sequence of  1,000  proteins
───────┼──────────────────────────────────────────────────────────────────────────────────────────────────────────────
      1│ GTGATTTTT AGCGCGTTTT GTAGCGCTCT AAAAACCGTA GCTATATTTC TCGAAGTTTC ACCCAGCTCT TTTGCCCCAG GGTTGCGCTA AGCCCAGCTT
    101│ GAGGGGGGC ACAGGTAAAA TACTACCGTC CGTGGAGGGG GATGAATTGA CCCGACATTT TTTGAAGCAT AACTCGTGAC TCAATATTGC ATGATTACAC
    201│ AGCTAGGTT AGTGTAAAAA CCCCCCTATC TTCCTGATCA ATGGCGAGTA AAACATGCAA CCAATTTGTG AGCGAGTACT GGAAATTATT GTTTACGGGA
    301│ AGGCACATG CTACGCGCAA CAGATATCTT AGACTGACCC TTTTAGAGTC ATAAGCCCCT GTCGCCTACA TGCTACTAAT ACTCCAACTA GCGGCGCACC
    401│ TCAACCGGA TCATGGCGCC AGGGAAAATG TGGCGTAGCG ACGTGCTCAT CGCTCGCCGG GGAGAGCCTT TCAGAATCTC GAATAAAACC TGGTAATGAC
    501│ TCATCAATC GTAATGGTCG TCTGGGGCAA GAAGCCGATA TTATAGACTC AGGTCAGACG TGTGCACAAC GGCAGAATTT ATAGTAATTC GCGTGAACTA
    601│ GTTTCGGGA TAGGCCTACG ACCAATCATA GGACATTCGA TGCACGGTGT AGAAACAGTT CTCTGATGTT ACTCGGGATA ACACTCGCAA TCCCCTAGGA
    701│ ACCGTGAGC GTCGCTAGTA TCTGAGATAG TCGCGACTGC CCAGCGGTCT TTAAGTTCGC ACACTACGGG ACTCCTAGTT CGCCCATTCA TGGCTATTTT
    801│ CCTATCAGT CCAATCCCAC GGGGAGGGCA CTCGCGCAAT TCATTCAAAG AGGGCCATTT GCCGATATAA GGTCCATCAT CGGGAGGAAT ATGACTCCTG
    901│ TTAGTATTA GAGCAGCCTC GCTGCGTACT ACTGTCAGTG GCCCGTCAGG GAAGGCAAAA CGTTTTTCCT CTAGGAATCC GTCAATTGGA CTTCTAGACT
───────┴──────────────────────────────────────────────────────────────────────────────────────────────────────────────

  base DNA proteins used:  ACGT
random DNA proteins used:  TTTT

the random DNA proteins were found in positions: 5 6 16 69 157 158 159 340 796 797 962 963

Ring[edit]

/*-----------------------------------
# Project : DNA subsequences
# Date    : 2021/03/23
# Author  : Gal Zsolt (~ CalmoSoft ~)
# Email   : <calmosoft@gmail.com>
-----------------------------------*/

//-----------------------------------------

load "stdlibcore.ring"
load "guilib.ring"

start = 0
base = ["A","C","G","T"]
dnaList = []
dnaSeq = []
ColLine = list(21) 

C_Spacing = 2 

C_ButtonDnaStyle  = ' background-color: Red; border-radius: 8px;' 
C_ButtonStyle  = '"background-color:white"; border-radius: 8px;'
Button = newlist(10,20)
LayoutButtonRow = list(10)

//-----------------------------------------

app = new qApp 
{
      win = new qWidget() {
            setWindowTitle('DNA subsequences')
	    setWinIcon(self,AppFile("white.jpg"))
            setStyleSheet('background-color:White')
            setgeometry(560,180,300,300)
            //reSize(400,400)
            winheight = 10 
            fontSize = 8 # + (winheight / 100)

            LayoutButtonMain = new QVBoxLayout()            
            LayoutButtonMain.setSpacing(C_Spacing)
            LayoutButtonMain.setContentsmargins(0,0,0,0)

            LabelInd = new qLabel(win) { settext("    DNA subsequences start positions:")
                                         setAlignment(Qt_AlignHCenter | Qt_AlignVCenter)
                                         setStyleSheet("background-color:yellow") }

            ButtonInd = new QPushButton(win) { setStyleSheet("background-color:yellow") }

            LabelFind = new qLabel(win) { settext("    DNA subsequence to find:")
                                          setStyleSheet("background-color:yellow") }

            ButtonFind = new QPushButton(win)

            DnaSearch = new QPushButton(win) { setclickevent("pstart()")
                                               setStyleSheet("background-color:yellow")
                                               settext("Find")
                                             }
    
            for Col = 1 to 21
                ColLine[Col] = new qLabel(win) {
                                setmaximumheight(20)
                                setAlignment(Qt_AlignHCenter | Qt_AlignVCenter) 
                                setStyleSheet("background-color:darkgray")
                                setText(string(Col-1))
                                } 
            next

            LayoutInd = new QHBoxLayout() { setSpacing(C_Spacing) setContentsMargins(0,0,0,0) }
            LayoutInd.AddWidget(LabelInd) 
            LayoutInd.AddWidget(ButtonInd) 
            LayoutButtonMain.AddLayout(LayoutInd) 
                
            LayoutTitleRow = new QHBoxLayout() { setSpacing(C_Spacing) setContentsMargins(0,0,0,0) }

                for Col = 1 to 21                
                    LayoutTitleRow.AddWidget(ColLine[Col])         
                next
                            
            LayoutButtonMain.AddLayout(LayoutTitleRow)  
            
            RowLine = list(10)  

            for Row = 1 to 10
                Letter = "" + Row*20
                if Row*20 < 100
                   Letter = "  " + Row*20
                ok
                RowLine[Row] = new qLabel(win) { setFont(new qFont("Verdana",fontSize,40,0))
                                                 setAlignment(Qt_AlignHCenter | Qt_AlignVCenter) 
                                                 setStyleSheet("background-color:darkgray")
                                                 setText(Letter)
                                               } 
            next

            for Row = 1 to 10
                LayoutButtonRow[Row] = new QHBoxLayout()    
                {
                    setSpacing(C_Spacing)
                    setContentsmargins(0,0,0,0)
                } 

               LayoutButtonRow[Row].AddWidget(RowLine[Row])
               
               for Col = 1 to 20
                    Button[Row][Col] = new QPushButton(win) {
                                       setmaximumwidth(20) 
                                       }
                    LayoutButtonRow[Row].AddWidget(Button[Row][Col])    
               next
               
               LayoutButtonMain.AddLayout(LayoutButtonRow[Row])         
            next

            LayoutDataRow = new QHBoxLayout() { setSpacing(C_Spacing) setContentsMargins(0,0,0,0) }

            LayoutDataRow.AddWidget(LabelFind)
            LayoutDataRow.AddWidget(ButtonFind)               
            LayoutDataRow.AddWidget(DnaSearch)
            LayoutButtonMain.AddLayout(LayoutDataRow) 
                  
            setLayout(LayoutButtonMain)
            
            pStart()
            show()
   }
   exec()
 }

//-----------------------------------------

func pStart()
     start = start + 1

     dnaList = []
     for row = 1 to 10
         for col = 1 to 20
             Button[row][col].settext("")
         next
     next
     for nr = 1 to 200
         rnd = random(3)+1
         baseStr = base[rnd]
         row = ceil(nr/20)
         col = nr%20
         if col = 0
            col = 20
         ok
         Button[row][col].settext(baseStr)
         add(dnaList,baseStr)
     next

     startDna()

//-----------------------------------------

func startDna()

     strDna = list2str(dnaList)
     strDna = substr(strDna,nl,"")

     while true
           strBase = ""
           for n = 1 to 4
               rnd = random(3)+1
               strBase = strBase + base[rnd]
           next
           ind = substr(strDna,strBase)
           if ind > 0
              exit
           ok
     end

     showDna(dnaList)

//-----------------------------------------

func showDna(dnaList)


     if start > 1
     see nl
     for n = 1 to len(dnaSeq)
         for m = 0 to 3
             ind = dnaSeq[n] + m
             row = ceil(ind/20)
             col = ind%20
             if col = 0
                col = 20
             ok
             Button[row][col].setstylesheet(C_ButtonStyle)
         next
     next
     ok


     dnaSeq = []
     strDna = list2str(dnaList)
     strDna = substr(strDna,nl,"")

     while true
           strBase = ""
           for n = 1 to 4
               rnd = random(3)+1
               strBase = strBase + base[rnd]
           next
           ind = substr(strDna,strBase)
           if ind > 0
              exit
           ok
     end

     ButtonFind.setStyleSheet("background-color:yellow")
     ButtonFind.settext(strBase)

     for n = 1 to 196
         flag = 1
         for m = 0 to 3
             if dnaList[n+m] != strBase[m+1]
                flag = 0
                exit
             ok
         next
         if flag = 1
            add(dnaSeq,n)
         ok
     next
     
     temp = ""
     ButtonInd.settext("")
     for nr = 1 to len(dnaList)
         ind = find(dnaSeq,nr)
         if ind > 0
            temp = temp + string(dnaSeq[ind]) + " "
            ButtonInd.settext(temp)
            for n = nr to nr + 3
                row = ceil(n/20)
                col = n%20
                if col = 0
                   col = 20
                ok
                Button[row][col].setStyleSheet(C_ButtonDnaStyle)
                Button[row][col].settext(dnaList[n])
            next
         ok
      next           

//-----------------------------------------

Output:

Bioinformatics/Subsequence - video

Wren[edit]

Library: Wren-pattern
Library: Wren-str
Library: Wren-fmt
import "random" for Random
import "/pattern" for Pattern
import "/str" for Str
import "/fmt" for Fmt

var rand = Random.new()
var base = "ACGT"

var findDnaSubsequence = Fn.new { |dnaSize, chunkSize|
    var dnaSeq = List.filled(dnaSize, null)
    for (i in 0...dnaSize) dnaSeq[i] = base[rand.int(4)]
    var dnaStr = dnaSeq.join()
    var dnaSubseq = List.filled(4, null)
    for (i in 0...4) dnaSubseq[i] = base[rand.int(4)]
    var dnaSubstr = dnaSubseq.join()
    System.print("DNA sequence:")
    var i = chunkSize
    for (chunk in Str.chunks(dnaStr, chunkSize)) {
         Fmt.print("$3d..$3d: $s", i - chunkSize + 1, i, chunk)
         i = i + chunkSize
    }
    System.print("\nSubsequence to locate: %(dnaSubstr)")
    var p = Pattern.new(dnaSubstr)
    var matches = p.findAll(dnaStr)
    if (matches.count == 0) {
        System.print("No matches found.")
    } else {
        System.print("Matches found at the following indices:")
        for (m in matches) {
            Fmt.print("$3d..$3d", m.index + 1, m.index + 4)
        }
    }
}

findDnaSubsequence.call(200, 20)
System.print()
findDnaSubsequence.call(600, 40)
Output:
DNA sequence:
  1.. 20: TATGGGCGCATTATGACAAC
 21.. 40: GGCTACTGAAACGAAAATTC
 41.. 60: ATGCCTTCGGAGGCTAGACC
 61.. 80: ACTCATACATGATTTACAGC
 81..100: TAGTCAGTTGCGTCCGCCAT
101..120: CCCGCATAACTATGTATTAC
121..140: GAGCATGTTCTGGCAACCTT
141..160: TCAGTGACAGTTCCTCAGGC
161..180: GCGTTCGCGTTGAAGGCCTC
181..200: CCCACACCGCACCCCTGCCG

Subsequence to locate: AATT
Matches found at the following indices:
 36.. 39

DNA sequence:
  1.. 40: GCGCTGAGCGCCCCAGTACAGCGGGTTAAACCGAGCCCGC
 41.. 80: TCCGATGAACCAACTCCCATTCCTATAATGGTGCCCCGAC
 81..120: ATATTGAATTCGGCGGGTCCGCTATCGGGCTGAGGATGCC
121..160: AATATCTAGGCGCTACCCTGAAGATCCTCAGTTGTGGTGT
161..200: CGCGGAGTGTCGATCCCAGAGCTCCCAATTGACTCAATTA
201..240: CTTTTTCCGTCCTCTTGCTTACGGATTTATGTTTGTGGCA
241..280: GAGGTTATGCTTCAGGCATCCCCATGTTTCCTGAGATACG
281..320: ACCACTGTCAGGTGGCTTGAATCTACCTTGTATTTCCTCT
321..360: AGTACCAGTCACTGTCATCTACTGGAAGCCATATCAGCGT
361..400: TGAAATGTCTATAATTTACTCTCCGGTTGTACCCAAGCGA
401..440: TAACAGCAACGTGTGGGTCTAAAGAGTTCCGCGTTTCGAC
441..480: ATAACGTGCTCCTATTTATCTACCGAAACACCCTATTTTC
481..520: CATCTAACCGGCACCCAATGCGCAGGTGTACGCGTCCTAC
521..560: TACGTTTGAAACGGTTCCATCTCGCCATGTACAATTGTGG
561..600: GGCTACGATTAAGTGTAGTCGGTAATTCAGGGTGAAGTTG

Subsequence to locate: TTCG
Matches found at the following indices:
 89.. 92
435..438