Bioinformatics/Global alignment

From Rosetta Code
Task
Bioinformatics/Global alignment
You are encouraged to solve this task according to the task description, using any language you may know.

Global alignment is designed to search for highly similar regions in two or more DNA sequences, where the sequences appear in the same order and orientation, fitting the sequences in as pieces in a puzzle.

Current DNA sequencers find the sequence for multiple small segments of DNA which have mostly randomly formed by splitting a much larger DNA molecule into shorter segments. When re-assembling such segments of DNA sequences into a larger sequence to form, for example, the DNA coding for the relevant gene, the overlaps between multiple shorter sequences are commonly used to decide how the longer sequence is to be assembled. For example, "AAGATGGA", GGAGCGCATC", and "ATCGCAATAAGGA" can be assembled into the sequence "AAGATGGAGCGCATCGCAATAAGGA" by noting that "GGA" is at the tail of the first string and head of the second string and "ATC" likewise is at the tail of the second and head of the third string.

When looking for the best global alignment in the output strings produced by DNA sequences, there are typically a large number of such overlaps among a large number of sequences. In such a case, the ordering that results in the shortest common superstring is generrally preferred.

Finding such a supersequence is an NP-hard problem, and many algorithms have been proposed to shorten calculations, especially when many very long sequences are matched.

The shortest common superstring as used in bioinfomatics here differs from the string task Shortest_common_supersequence. In that task, a supersequence may have other characters interposed as long as the characters of each subsequence appear in order, so that (abcbdab, abdcaba) -> abdcabdab. In this task, (abcbdab, abdcaba) -> abcbdabdcaba.


Task
  •   Given N non-identical strings of characters A, C, G, and T representing N DNA sequences, find the shortest DNA sequence containing all N sequences.
  •   Handle cases where two sequences are identical or one sequence is entirely contained in another.
  •   Print the resulting sequence along with its size (its base count) and a count of each base in the sequence.
  •   Find the shortest common superstring for the following four examples:
 
("TA", "AAG", "TA", "GAA", "TA")
("CATTAGGG", "ATTAG", "GGG", "TA")
("AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA")
("ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT",
"GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT",
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT",
"GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC",
"CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT",
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC",
"GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT",
"TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
"TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA")
Related tasks



11l[edit]

Translation of: Nim
-V ACGT = [‘A’, ‘C’, ‘G’, ‘T’]

F permutations(slist)
   V l = sorted(slist)
   V r = [l]
   L l.next_permutation()
      r [+]= copy(l)
   R r

F printCounts(dnaSeq)
   DefaultDict[Char, Int] counts
   L(c) dnaSeq
      counts[c]++
   print("\nNucleotide counts for #.:\n".format(dnaSeq))
   L(base) :ACGT
      print(‘#10 #11’.format(base, counts[base]))
   V others = 0
   L(base) counts.keys()
      I base !C :ACGT
         others += counts[base]
   print(‘     Other #11’.format(others))
   print(‘  --------------------’)
   print(‘  Total length #7’.format(dnaSeq.len))

F headTailOverlap(s1, s2)
   V start = 0
   L
      V? n = s1.find(s2[0], start)
      I n == N
         R 0
      start = n
      I s2.starts_with(s1[start..])
         R s1.len - start
      start++

F deduplicate(slist)
   [String] r
   V s = Set(slist)
   L(s1) s
      V i = L.index
      L(s2) s
         I L.index != i & s1 C s2
            L.break
      L.was_no_break
         r.append(s1)
   R r

F shortestCommonSuperstring(sl)
   V slist = deduplicate(sl)
   V result = slist.join(‘’)
   L(perm) permutations(slist)
      String sup = perm[0]
      L(i) 0 .< slist.len - 1
         V overlapPos = headTailOverlap(perm[i], perm[i + 1])
         sup ‘’= perm[i + 1][overlapPos..]
      I sup.len < result.len
         result = sup
   R result

V TestSequences = [
   [‘TA’, ‘AAG’, ‘TA’, ‘GAA’, ‘TA’],
   [‘CATTAGGG’, ‘ATTAG’, ‘GGG’, ‘TA’],
   [‘AAGAUGGA’, ‘GGAGCGCAUC’, ‘AUCGCAAUAAGGA’],
   [‘ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT’,
    ‘GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT’,
    ‘CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA’,
    ‘TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC’,
    ‘AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT’,
    ‘GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC’,
    ‘CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT’,
    ‘TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC’,
    ‘CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC’,
    ‘GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT’,
    ‘TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC’,
    ‘CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA’,
    ‘TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA’]]

L(test) TestSequences
   V scs = shortestCommonSuperstring(test)
   printCounts(scs)
Output:

Nucleotide counts for GAAGTA:

         A           3
         C           0
         G           2
         T           1
     Other           0
  --------------------
  Total length       6

Nucleotide counts for CATTAGGG:

         A           2
         C           1
         G           3
         T           2
     Other           0
  --------------------
  Total length       8

Nucleotide counts for AAGAUGGAGCGCAUCGCAAUAAGGA:

         A          10
         C           4
         G           8
         T           0
     Other           3
  --------------------
  Total length      25

Nucleotide counts for CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA:

         A          74
         C          57
         G          75
         T          94
     Other           0
  --------------------
  Total length     300

Go[edit]

Translation of: Julia
package main

import (
    "fmt"
    "strings"
)

/* Gets n! for small n. */
func factorial(n int) int {
    fact := 1
    for i := 2; i <= n; i++ {
        fact *= i
    }
    return fact
}

/* Gets all permutations of a list of strings. */
func getPerms(input []string) [][]string {
    perms := [][]string{input}
    le := len(input)
    a := make([]string, le)
    copy(a, input)
    n := le - 1
    fact := factorial(n + 1)

    for c := 1; c < fact; c++ {
        i := n - 1
        j := n
        for i >= 0 && a[i] > a[i+1] {
            i--
        }
        if i == -1 {
            i = n
        }
        for a[j] < a[i] {
            j--
        }
        a[i], a[j] = a[j], a[i]
        j = n
        i++
        if i == n+1 {
            i = 0
        }
        for i < j {
            a[i], a[j] = a[j], a[i]
            i++
            j--
        }
        b := make([]string, le)
        copy(b, a)
        perms = append(perms, b)
    }
    return perms
}

/* Returns all distinct elements from a list of strings. */
func distinct(slist []string) []string {
    distinctSet := make(map[string]int, len(slist))
    i := 0
    for _, s := range slist {
        if _, ok := distinctSet[s]; !ok {
            distinctSet[s] = i
            i++
        }
    }
    result := make([]string, len(distinctSet))
    for s, i := range distinctSet {
        result[i] = s
    }
    return result
}

/* Given a DNA sequence, report the sequence, length and base counts. */
func printCounts(seq string) {
    bases := [][]rune{{'A', 0}, {'C', 0}, {'G', 0}, {'T', 0}}
    for _, c := range seq {
        for _, base := range bases {
            if c == base[0] {
                base[1]++
            }
        }
    }
    sum := 0
    fmt.Println("\nNucleotide counts for", seq, "\b:\n")
    for _, base := range bases {
        fmt.Printf("%10c%12d\n", base[0], base[1])
        sum += int(base[1])
    }
    le := len(seq)
    fmt.Printf("%10s%12d\n", "Other", le-sum)
    fmt.Printf("  ____________________\n%14s%8d\n", "Total length", le)
}

/* Return the position in s1 of the start of overlap of tail of string s1 with head of string s2. */
func headTailOverlap(s1, s2 string) int {
    for start := 0; ; start++ {
        ix := strings.IndexByte(s1[start:], s2[0])
        if ix == -1 {
            return 0
        } else {
            start += ix
        }
        if strings.HasPrefix(s2, s1[start:]) {
            return len(s1) - start
        }
    }
}

/* Remove duplicates and strings contained within a larger string from a list of strings. */
func deduplicate(slist []string) []string {
    var filtered []string
    arr := distinct(slist)
    for i, s1 := range arr {
        withinLarger := false
        for j, s2 := range arr {
            if j != i && strings.Contains(s2, s1) {
                withinLarger = true
                break
            }
        }
        if !withinLarger {
            filtered = append(filtered, s1)
        }
    }
    return filtered
}

/* Returns shortest common superstring of a list of strings. */
func shortestCommonSuperstring(slist []string) string {
    ss := deduplicate(slist)
    shortestSuper := strings.Join(ss, "")
    for _, perm := range getPerms(ss) {
        sup := perm[0]
        for i := 0; i < len(ss)-1; i++ {
            overlapPos := headTailOverlap(perm[i], perm[i+1])
            sup += perm[i+1][overlapPos:]
        }
        if len(sup) < len(shortestSuper) {
            shortestSuper = sup
        }
    }
    return shortestSuper
}

func main() {
    testSequences := [][]string{
        {"TA", "AAG", "TA", "GAA", "TA"},
        {"CATTAGGG", "ATTAG", "GGG", "TA"},
        {"AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA"},
        {
            "ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT",
            "GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT",
            "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
            "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
            "AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT",
            "GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC",
            "CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT",
            "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
            "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC",
            "GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT",
            "TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
            "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
            "TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA",
        },
    }

    for _, test := range testSequences {
        scs := shortestCommonSuperstring(test)
        printCounts(scs)
    }
}
Output:
Nucleotide counts for TAAGAA:

         A           4
         C           0
         G           1
         T           1
     Other           0
  ____________________
  Total length       6

Nucleotide counts for CATTAGGG:

         A           2
         C           1
         G           3
         T           2
     Other           0
  ____________________
  Total length       8

Nucleotide counts for AAGAUGGAGCGCAUCGCAAUAAGGA:

         A          10
         C           4
         G           8
         T           0
     Other           3
  ____________________
  Total length      25

Nucleotide counts for CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA:

         A          74
         C          57
         G          75
         T          94
     Other           0
  ____________________
  Total length     300

jq[edit]

Works with: jq

Works with gojq, the Go implementation of jq

### Generic helper functions

# bag-of-words
def bow(stream): 
  reduce stream as $word ({}; .[($word|tostring)] += 1);

def permutations:
  if length == 0 then []
  else
    range(0;length) as $i
    | [.[$i]] + (del(.[$i])|permutations)
  end ;
# Give a synoptic view of the input string,
# highlighting the occurrence of ACGTU letters
def synopsis:
  ["A", "C", "G", "T", "U"] as $standard
  | . as $seq
  | bow(explode | map([.]|implode)[]) as $bases
  | ("Nucleotide counts for \($seq):\n"),
    (($standard + ($bases|keys - $standard))[] | "\(.): \($bases[.]//0)"),
    "__",
    "Σ: \($seq|length)" ;

# If the strings, $s1 and $s2, overlap by at least $minimumoverlap characters,
# return { i1: <index in $s1 where overlap starts>,  overlap: <overlapping string>},
# otherwise, return null
def overlap_info($s1; $s2; $minimumoverlap):
  first( range(0; $s1|length + 1 - $minimumoverlap) as $i1
         | $s1[$i1:] as $overlap
         | select($s2 | startswith($overlap))
	 | {$i1, $overlap} ) // null ;

# Input: an array of strings
# Remove duplicates and strings contained within a larger string
def deduplicate:
  unique
  | . as $arr
  | reduce range(0;length) as $i ([];
      $arr[$i] as $s1
      | if any( $arr[] | select(. != $s1); index($s1))
        then .
	else . + [$s1]
	end);

# Given an array of deduplicated strings, attempt to find a superstring
# composed of these strings in the same order;
# return it if found, else null.
def relevant($min):
  . as $in
  | length as $length
  | {s: .[0], i:0}
  | until (.s == null or .i >= $length - 1;
       .i as $i
       # Since the strings have been deduplicated we can use $in[$i]:
       | overlap_info($in[$i]; $in[$i+1]; $min) as $overlap
       | if $overlap then .s += $in[$i+1][$overlap.overlap|length:]
         else .s = null
	 end
       | .i += 1 )
   | .s ;
     
# Input: an array of strings
# Return shortest common superstring
def shortest_common_superstring:
  deduplicate as $ss
  | reduce ($ss | permutations) as $perm ({shortestsuper: ($ss | add) };
      ($perm | relevant(1)) as $candidate
      | if $candidate and ($candidate|length) < (.shortestsuper|length)
        then .shortestsuper = $candidate
        else . end)
  | .shortestsuper;

The specific tasks

def examples:
 [
  ["TA", "AAG", "TA", "GAA", "TA"],

  ["CATTAGGG", "ATTAG", "GGG", "TA"],

  ["AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA"],

  ["ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT",
   "GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT",
   "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
   "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
   "AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT",
   "GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC",
   "CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT",
   "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
   "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC",
   "GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT",
   "TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
   "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
   "TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA"]
  ];

def tasks:
  def t: shortest_common_superstring | synopsis;

  examples
  | . as $examples
  | range(0;length) as $i
  |  "Task \($i+1):", ($examples[$i]|t), "";

tasks
Output:
Task 1:
Nucleotide counts for TAAGAA:

A: 4
C: 0
G: 1
T: 1
U: 0
__
Σ: 6

Task 2:
Nucleotide counts for CATTAGGG:

A: 2
C: 1
G: 3
T: 2
U: 0
__
Σ: 8

Task 3:
Nucleotide counts for AAGAUGGAGCGCAUCGCAAUAAGGA:

A: 10
C: 4
G: 8
T: 0
U: 3
__
Σ: 25

Task 4:
Nucleotide counts for CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA:

A: 74
C: 57
G: 75
T: 94
U: 0
__
Σ: 300

Julia[edit]

using Combinatorics

""" Given a DNA sequence, report the sequence, length and base counts"""
function printcounts(seq)
    bases = [['A', 0], ['C', 0], ['G', 0], ['T', 0]]
    for c in seq, base in bases
        if c == base[1]
            base[2] += 1
        end
    end
    println("\nNucleotide counts for $seq:\n")
    for base in bases
        println(lpad(base[1], 10), lpad(string(base[2]), 12))
    end
    println(lpad("Other", 10), lpad(string(length(seq) - sum(x[2] for x in bases)), 12))
    println("     _________________\n", lpad("Total length", 14), lpad(string(length(seq)), 8))
end

"""Return the position in s1 of the start of overlap of tail of string s1 with head of string s2"""
function headtailoverlap(s1, s2, minimumoverlap=1)
    start = 1
    while true
        range = findnext(s2[1:minimumoverlap], s1, start)
        range == nothing && return 0
        start = range.start
        startswith(s2, s1[start:end]) && return length(s1) - start + 1
        start += 1
    end
end

"""Remove duplicates and strings contained within a larger string from vector of strings"""
function deduplicate(svect)
    filtered = empty(svect)
    arr = unique(svect)
    for (i, s1) in enumerate(arr)
        any(p -> p[1] != i && occursin(s1, p[2]), enumerate(arr)) && continue
        push!(filtered, s1)
    end
    return filtered
end

"""Returns shortest common superstring of a vector of strings"""
function shortest_common_superstring(svect)
    ss = deduplicate(svect)
    shortestsuper = prod(ss)
    for perm in permutations(ss)
        sup = first(perm)
        for i in 1:length(ss)-1
            overlap_position = headtailoverlap(perm[i], perm[i+1], 1)
            sup *= perm[i + 1][overlap_position+1:end]
        end
        if length(sup) < length(shortestsuper)
            shortestsuper = sup
        end
    end
    return shortestsuper
end

testsequences = [
["TA", "AAG", "TA", "GAA", "TA"],
["CATTAGGG", "ATTAG", "GGG", "TA"],
["AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA"],
["ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT",
"GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT",
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT",
"GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC",
"CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT",
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC",
"GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT",
"TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
"TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA"]
]

for test in testsequences
    scs = shortest_common_superstring(test)
    printcounts(scs)
end
Output:
Nucleotide counts for TAAGAA:

         A           4
         C           0
         G           1
         T           1
     Other           0
     _________________
  Total length       6

Nucleotide counts for CATTAGGG:

         A           2
         C           1
         G           3
         T           2
     Other           0
     _________________
  Total length       8

Nucleotide counts for AAGAUGGAGCGCAUCGCAAUAAGGA:

         A          10
         C           4
         G           8
         T           0
     Other           3
     _________________
  Total length      25

Nucleotide counts for CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA:

         A          74
         C          57
         G          75
         T          94
     Other           0
     _________________
  Total length     300

Nim[edit]

Translation of: Wren
import algorithm, sequtils, strformat, strutils, tables

const ACGT = ['A', 'C', 'G', 'T']   # Four DNA bases.

iterator permutations(slist: seq[string]): seq[string] =
  var slist = sorted(slist)
  yield slist
  while slist.nextPermutation():
    yield slist


proc printCounts(dnaSeq: string) =
  ## Given a DNA sequence, report the sequence, length and base counts.
  let counts = dnaSeq.toCountTable()
  echo &"\nNucleotide counts for {dnaSeq}:\n"
  for base in ACGT:
    echo &"{($base):>10} {counts[base]:11}"
  var others = 0
  for base in counts.keys:
    if base notin ACGT: inc others, counts[base]
  echo &"     Other {others:11}"
  echo &"  ————————————————————"
  echo &"  Total length {dnaSeq.len: 7}"


func headTailOverlap(s1, s2: string): int =
  ## Return the position in "s1" of the start of overlap
  ## of tail of string "s1" with head of string "s2".
  var start = 0
  while true:
    start = s1.find(s2[0], start)
    if start < 0: return 0
    if s2.startsWith(s1[start..^1]): return s1.len - start
    inc start


proc deduplicate(slist: seq[string]): seq[string] =
  ## Remove duplicates and strings contained within a larger string from a list of strings.
  let slist = sequtils.deduplicate(slist)
  for i, s1 in slist:
    block check:
      for j, s2 in slist:
        if j != i and s1 in s2:
          break check
      # "s1" is not contained in another string.
      result.add s1


func shortestCommonSuperstring(slist: seq[string]): string =
  ## Return shortest common superstring of a list of strings.

  let slist = slist.deduplicate()
  result = slist.join()
  for perm in slist.permutations():
    var sup = perm[0]
    for i in 0..<slist.high:
      let overlapPos = headTailOverlap(perm[i], perm[i+1])
      sup &= perm[i+1][overlapPos..^1]
    if sup.len < result.len: result = sup


const TestSequences = [
  @["TA", "AAG", "TA", "GAA", "TA"],
  @["CATTAGGG", "ATTAG", "GGG", "TA"],
  @["AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA"],
  @["ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT",
    "GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT",
    "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
    "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
    "AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT",
    "GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC",
    "CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT",
    "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
    "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC",
    "GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT",
    "TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
    "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
    "TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA"]]

for test in TestSequences:
  let scs = test.shortestCommonSuperstring
  scs.printCounts()
Output:
Nucleotide counts for GAAGTA:

         A           3
         C           0
         G           2
         T           1
     Other           0
  ————————————————————
  Total length       6

Nucleotide counts for CATTAGGG:

         A           2
         C           1
         G           3
         T           2
     Other           0
  ————————————————————
  Total length       8

Nucleotide counts for AAGAUGGAGCGCAUCGCAAUAAGGA:

         A          10
         C           4
         G           8
         T           0
     Other           3
  ————————————————————
  Total length      25

Nucleotide counts for CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA:

         A          74
         C          57
         G          75
         T          94
     Other           0
  ————————————————————
  Total length     300

Pascal[edit]

Used a matrix of head-tail overlapping and modified n-queens to generate the permutations.
Here nearly no runtime.But see N-queens_problem that using permutation is not the way for > 17
Of course this is more a traveling salesman problem.

program BaseInDNA;
{$IFDEF FPC}
  {$mode Delphi}  {$Optimization ON,All}
{$ELSE}
  {$APPTYPE CONSOLE}
{$ENDIF}
uses
  sysutils,classes;
type
  tmyString = AnsiString;//[255];
  tpMyString = ^tmyString;
  tOvrLapMat = array of array of Int32;
  tNextDNA = array of Int32;
  tpNextDNA = pInt32;
const
  convDgtBase :array['1'..'5'] of char = ('A','C','G','T','U');

  Test1 : array[0..4] of tmyString = ('TA','AAG','TA','GAA','TA');
  Test2 : array[0..3] of tmyString = ('CATTAGGG', 'ATTAG', 'GGG', 'TA');
  Test3 : array[0..2] of tmyString = ('AAGAUGGA', 'GGAGCGCAUC', 'AUCGCAAUAAGGA');
  Test4 : array[0..12] of tmyString =
('ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT',
'GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT',
'CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA',
'TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC',
'AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT',
'GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC',
'CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT',
'TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC',
'CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC',
'GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT',
'TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC',
'CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA',
'TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA');
var
  sl_DNA : TStringList;
  OverlapMat : tOvrLapMat;
  SolDNA : tNextDNA;
  pNextDNA : tpNextDNA;
  DNA_Count,MAX,LastMax : Int32;

function ConvertACGT_1234(const s:AnsiString):AnsiString;
const
  conv :array['A'..'U'] of char = ('1',#0,'2',#0,#0,#0,'3',#0,#0,
                                   #0,#0,#0,#0,#0,#0,#0,#0,#0,
                                   #0,'4','5');
var
  pC: pChar;
  i : NativeInt;
begin
  i := Length(s);
  setlength(result,i);
  pC := @result[1];
  dec(i);
  while i >= 0 do
  Begin
    pC[i] := conv[s[i+1]];
    dec(i);
  end;
end;

function Convert1234_ACGTU(const s:AnsiString):AnsiString;
var
  pC: pChar;
  i : NativeInt;
begin
  i := Length(s);
  setlength(result,i);
  pC := @result[1];
  dec(i);
  while i >= 0 do
  Begin
    pC[i] := convDgtBase[s[i+1]];
    dec(i);
  end;
end;

procedure Check_Base_Count(const s: ANsiString);
var
  bc : ANsiString;
  BaseCnt : array[0..4] of UInt32;
  pC: pChar;
  i : NativeInt;
Begin
  writeln('Total length : ',Length(s));
  bc := ConvertACGT_1234(s);
  FillChar(BaseCnt,SizeOf(BaseCnt),#0);
  pC := @bc[1];
  for i := length(bc)-1 downto 0 do
    inc(BaseCnt[Ord(pC[i])-Ord('1')]);
  For i := 0 to 4 do
    write(convDgtBase[chr(i+49)],' : ',BaseCnt[i]:3,'  ');
  writeln;
end;

procedure extract_double(var sl : TStringList);
var
  i,j : NativeInt;
begin
  sl.sort;
  for i := sl.count-2 downto 0 do
    if sl[i] = sl[i+1] then
      sl.delete(i+1);

  i := sl.count-1;
  repeat
    For j := i-1 Downto 0 do
    Begin
      if (Pos(sl[j],sl[i]) >0) then
      Begin
        sl.delete(j);
        i := sl.count;
        BREAK;
      end
      else
        if (Pos(sl[i],sl[j]) >0) then
        Begin
          sl.delete(i);
        i := sl.count;
        BREAK;
        end;
    end;
    dec(i);
  until i < 1;
end;

procedure InsertSL(var sl : TStringList;pS :tpMyString;cnt:NativeInt);
Begin
  sl.clear;
  while cnt > 0 do
  Begin
    sl.Append(pS^);
    inc(pS);
    dec(cnt);
  end;
  extract_double(sl);
  sl.sort;
end;

function Check_Head_Tail(const s1,s2: AnsiString):NativeInt;
var
  cH : AnsiChar;
  i,j,k : NativeInt;
Begin
  result := 0;
  j := length(s1);
  cH := s2[1];
  repeat
    if s1[j]= cH then
    Begin
      i:= 1;
      k := j;
      while (s1[k] = s2[i]) AND (k <= length(s1)) do
      begin
        inc(i);
        inc(k);
      end;
      if k > length(s1) then
        result := length(s1)-j+1;
    end;
    dec(j);
  until j <1;
end;

function CreateOvrLapMat(const sl_DNA:TStringList):tOvrLapMat;
var
  col,row,DNAlen : NativeInt;
begin
  DNAlen := sl_DNA.Count;
  setlength(result,DNAlen,DNAlen);

  dec(DNAlen);
  For row := DNAlen downto 0 do
    For col := DNAlen downto 0 do
      if row<>col then
        result[row,col] := Check_Head_Tail(sl_DNA[row],sl_DNA[col]);
{//output of matrix
  For row := 0 to DNAlen do
  Begin
    For col := 0 to DNAlen do
      write(OverlapMat[row,col]:3);
    writeln;
  end;
}

end;

procedure SetQueen(Row,sum,lastIdx:NativeInt);
var
  i,NextIdx,dSum : nativeInt;
begin
  IF row <= DNA_Count-1 then
  begin
    For i := row to DNA_Count-1 do
    begin
      NextIdx := pNextDNA[i];pNextDNA[i] := pNextDNA[Row];pNextDNA[Row] := NextIdx;
      dSum :=OverlapMat[lastidx,NextIdx];
      sum += dSum;
        SetQueen(Row+1,sum,NextIdx);
      sum -= dSum;
      pNextDNA[Row] := pNextDNA[i];pNextDNA[i] := NextIdx;
    end;
  end
  else
  begin
    //solution found could be modified MAX<=sum for more solutions of same length
    If MAX<sum then
    Begin
      MAX := sum;
      // remember the way 
      for i := DNA_Count-1 downto 0 do
        SolDNA[i+1] := pNextDNA[i];
    end;
  end;
end;

procedure Find;
var
  col,row,i : NativeInt;
  NextDNA : tNextDNA;
  Combined : AnsiString;
Begin
  DNA_Count := sl_DNA.count;

  IF DNA_Count = 1 then
    Combined := sl_DNA[0]
  else
  Begin
    setlength(SolDNA,DNA_count);
    dec(DNA_Count);
    setlength(NextDNA,DNA_count);

    //Tail-Head-Matrix
    OverlapMat := CreateOvrLapMat(sl_DNA);

    MAX := 0;
    LastMax := 0;
    pNextDNA := @NextDNA[0];
    //start with base_sequence[row]
    for row := 0 to DNA_count do
    begin
      i := 0;
      For col := 0 to DNA_count do
        if row<>col then
        begin
          pNextDNA[i] := col;
          inc(i);
        end;

        SetQueen(0,0,row);

       If LastMax< MAX then
       begin
         SolDNA[0]:= row;
         LastMax := MAX;
      end;
    end;
    Combined := '';
    for col := 0 to DNA_Count-1 do
    Begin
      write(SolDNA[col]+1,'->');
      row := length(sl_DNA[SolDNA[col]]);
      Combined += copy(sl_DNA[SolDNA[col]],1,row-OverlapMat[SolDNA[col],SolDNA[col+1]]);
    end;
    writeln(SolDNA[DNA_Count]+1);
    Combined += sl_DNA[SolDNA[DNA_Count]];

    LastMax := 0;
    for col := 0 to DNA_Count do
      inc(LastMax,Length(sl_DNA[col]));
    IF LastMax-MAX <> length(combined) then
      writeln(LastMax,'-',Max,' = ',LastMax-MAX,' ?=? ',length(combined));
  end;
  writeln(combined);
  Check_Base_Count(combined);
  writeln;
end;


BEGIN
  sl_DNA := TStringList.create;
  InsertSL(sl_DNA,@Test1[0],High(Test1)+1);
  find;
  InsertSL(sl_DNA,@Test2[0],High(Test2)+1);
  find;
  InsertSL(sl_DNA,@Test3[0],High(Test3)+1);
  find;
  InsertSL(sl_DNA,@Test4[0],High(Test4)+1);
  find;
END.
Output:
2->1->3
GAAGTA
Total length : 6
A :   3  C :   0  G :   2  T :   1  U :   0

CATTAGGG
Total length : 8
A :   2  C :   1  G :   3  T :   2  U :   0

1->3->2
AAGAUGGAGCGCAUCGCAAUAAGGA
Total length : 25
A :  10  C :   4  G :   8  T :   0  U :   3

1->6->7->5->4->2->3
CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
Total length : 300
A :  74  C :  57  G :  75  T :  94  U :   0

Perl[edit]

#!/usr/bin/perl

use strict; # https://rosettacode.org/wiki/Bioinformatics/global_alignment
use warnings;
use List::Util qw( first uniq );

my @seq = (
  [ qw( TA AAG TA GAA TA ) ],

  [ qw( CATTAGGG ATTAG GGG TA) ],

  [ qw( AAGAUGGA GGAGCGCAUC AUCGCAAUAAGGA ) ],

  [ qw(
  ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT
  GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT
  CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
  TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC
  AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
  GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC
  CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT
  TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC
  CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC
  GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT
  TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC
  CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
  TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA
  ) ],
  );

sub removedups # remove dups and subseqs
  {
  local $_ = join ' ', sort { length $a <=> length $b } split ' ', shift;
  1 while s/\b(\w+) (?=.*\1)//;
  return $_;
  }

for ( @seq )
  {
  local $_ = removedups join ' ', @$_;
  my @queue = $_;
  my @best;

  while( @queue )
    {
    local $_ = shift @queue;
    my @seq = split ' ', $_;
    my @over;
    for my $left ( @seq )
      {
      for my $right ( @seq )
        {
        $left eq $right and next;
        "$left $right" =~ /(.+) \1/ or next;
        my $len = length $1;
        $over[$len] .= "$left $right\n";
        }
      }
    if( @over )
      {
      for my $join ( split /\n/, $over[-1] )
        {
        my ($left, $right) = split ' ', $join;
        my @newseq = grep $_ ne $left && $_ ne $right, @seq; # remove used
        push @queue, removedups "$left $right" =~ s/(.+) (?=\1)//r .
          join ' ', '', @newseq;
        }
      }
    else
      {
      tr/ //d;
      $best[length] .= "$_\n";
      next;
      }
    }

  for ( uniq split /\n/, first {defined} @best )
    {
    printf "\nlength %d - %s\n", length, $_;
    my %ch;
    $ch{$_}++ for /./g;
    use Data::Dump 'dd'; dd \%ch;
    }
  }
Output:
length 6 - TAGAAG
{ A => 3, G => 2, T => 1 }

length 8 - CATTAGGG
{ A => 2, C => 1, G => 3, T => 2 }

length 25 - AAGAUGGAGCGCAUCGCAAUAAGGA
{ A => 10, C => 4, G => 8, U => 3 }

length 300 - CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
{ A => 74, C => 57, G => 75, T => 94 }

Phix[edit]

procedure printcounts(sequence ss)
-- Given DNA sequence(s), report the sequence, length and base counts
    for i=1 to length(ss) do
        string dna = ss[i]
        sequence acgt = repeat(0,6)
        for j=1 to length(dna) do
            acgt[find(dna[j],"ACGT")+1] += 1
        end for
        acgt[$] = sum(acgt)
        string ncf = "Nucleotide counts for :"
        printf(1,"%s%s\n",{ncf,join(split_by(dna,50),"\n"&repeat(' ',length(ncf)))})
        printf(1,"Base counts: Other:%d, A:%d, C:%d, G:%d, T:%d, total:%d\n\n",acgt)
    end for
end procedure
 
function deduplicate(sequence ss)
-- Remove any strings contained within a larger string from a set of strings
    sequence filtered = {}
    for i=1 to length(ss) do
        string si = ss[i]
        bool found = false
        for j=1 to length(ss) do
            if i!=j and match(si,ss[j]) then
                found = true
                exit
            end if
        end for
        if not found then
            filtered = append(filtered, si)
        end if
    end for
    return filtered
end function
 
procedure shortest_common_superstring(sequence ss)
-- Returns shortest common superstring of a set of strings
    ss = deduplicate(unique(ss))
    sequence shortestsuper = {join(ss,"")}
    integer shortest = length(shortestsuper[1])
    for p=1 to factorial(length(ss)) do
        sequence perm = permute(p,ss)
        string sup = perm[1]
        for i=2 to length(perm) do
            string pi = perm[i]
            for j=-min(length(pi),length(sup)) to 0 do
                string overlap = sup[j..$]
                if overlap = pi[1..length(overlap)] then
                    sup &= pi[length(overlap)+1..$]
                    pi = ""
                    exit
                end if
            end for
            if length(pi) then ?9/0 end if -- (sanity chk)
        end for
        if length(sup) < shortest then
            shortest = length(sup)
            shortestsuper = {sup}
        elsif length(sup) = shortest
          and not find(sup,shortestsuper) then
            shortestsuper = append(shortestsuper,sup)
        end if
    end for
    printcounts(shortestsuper)
end procedure
 
constant tests = {
{"TA", "AAG", "TA", "GAA", "TA"},
{"CATTAGGG", "ATTAG", "GGG", "TA"},
{"AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA"},
{"ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT",
"GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT",
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT",
"GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC",
"CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT",
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC",
"GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT",
"TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
"TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA"}
}
papply(tests, shortest_common_superstring)
Output:

(Shows three length-6 results for the first test)

Nucleotide counts for :TAAGAA
Base counts: Other:0, A:4, C:0, G:1, T:1, total:6

Nucleotide counts for :GAAGTA
Base counts: Other:0, A:3, C:0, G:2, T:1, total:6

Nucleotide counts for :TAGAAG
Base counts: Other:0, A:3, C:0, G:2, T:1, total:6

Nucleotide counts for :CATTAGGG
Base counts: Other:0, A:2, C:1, G:3, T:2, total:8

Nucleotide counts for :AAGAUGGAGCGCAUCGCAAUAAGGA
Base counts: Other:3, A:10, C:4, G:8, T:0, total:25

Nucleotide counts for :CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
                       CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
                       AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
                       GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
                       CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
                       TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
Base counts: Other:0, A:74, C:57, G:75, T:94, total:300

Python[edit]

Translation of: Go
import os

from collections import Counter
from functools import reduce
from itertools import permutations

BASES = ("A", "C", "G", "T")


def deduplicate(sequences):
    """Return the set of sequences with those that are a substring
    of others removed too."""
    sequences = set(sequences)
    duplicates = set()

    for s, t in permutations(sequences, 2):
        if s != t and s in t:
            duplicates.add(s)

    return sequences - duplicates


def smash(s, t):
    """Return `s` concatenated with `t`. The longest suffix of `s`
    that matches a prefix of `t` will be removed."""
    for i in range(len(s)):
        if t.startswith(s[i:]):
            return s[:i] + t
    return s + t


def shortest_superstring(sequences):
    """Return the shortest superstring covering all sequences. If
    there are multiple shortest superstrings, an arbitrary
    superstring is returned."""
    sequences = deduplicate(sequences)
    shortest = "".join(sequences)

    for perm in permutations(sequences):
        superstring = reduce(smash, perm)
        if len(superstring) < len(shortest):
            shortest = superstring

    return shortest


def shortest_superstrings(sequences):
    """Return a list of all shortest superstrings that cover
    `sequences`."""
    sequences = deduplicate(sequences)

    shortest = set(["".join(sequences)])
    shortest_length = sum(len(s) for s in sequences)

    for perm in permutations(sequences):
        superstring = reduce(smash, perm)
        superstring_length = len(superstring)
        if superstring_length < shortest_length:
            shortest.clear()
            shortest.add(superstring)
            shortest_length = superstring_length
        elif superstring_length == shortest_length:
            shortest.add(superstring)

    return shortest


def print_report(sequence):
    """Writes a report to stdout for the given DNA sequence."""
    buf = [f"Nucleotide counts for {sequence}:\n"]

    counts = Counter(sequence)
    for base in BASES:
        buf.append(f"{base:>10}{counts.get(base, 0):>12}")

    other = sum(v for k, v in counts.items() if k not in BASES)
    buf.append(f"{'Other':>10}{other:>12}")

    buf.append(" " * 5 + "_" * 17)
    buf.append(f"{'Total length':>17}{sum(counts.values()):>5}")

    print(os.linesep.join(buf), "\n")


if __name__ == "__main__":
    test_cases = [
        ("TA", "AAG", "TA", "GAA", "TA"),
        ("CATTAGGG", "ATTAG", "GGG", "TA"),
        ("AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA"),
        (
            "ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT",
            "GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT",
            "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
            "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
            "AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT",
            "GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC",
            "CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT",
            "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
            "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC",
            "GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT",
            "TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
            "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
            "TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA",
        ),
    ]

    for case in test_cases:
        for superstring in shortest_superstrings(case):
            print_report(superstring)

    # or ..
    #
    # for case in test_cases:
    #     print_report(shortest_superstring(case))
    #
    # .. if you don't want all possible shortest superstrings.
Output:
Nucleotide counts for GAAGTA:

         A           3
         C           0
         G           2
         T           1
     Other           0
     _________________
     Total length    6 

Nucleotide counts for TAAGAA:

         A           4
         C           0
         G           1
         T           1
     Other           0
     _________________
     Total length    6 

Nucleotide counts for TAGAAG:

         A           3
         C           0
         G           2
         T           1
     Other           0
     _________________
     Total length    6 

Nucleotide counts for CATTAGGG:

         A           2
         C           1
         G           3
         T           2
     Other           0
     _________________
     Total length    8 

Nucleotide counts for AAGAUGGAGCGCAUCGCAAUAAGGA:

         A          10
         C           4
         G           8
         T           0
     Other           3
     _________________
     Total length   25 

Nucleotide counts for CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA:

         A          74
         C          57
         G          75
         T          94
     Other           0
     _________________
     Total length  300

Raku[edit]

Translation of: Go
Translation of: Julia
# 20210209 Raku programming solution

sub printCounts(\seq) {
   my $bases = seq.comb.Bag ;
   say "\nNucleotide counts for ", seq, " :";
   say $bases.kv, " and total length = ", $bases.total
}

sub stringCentipede(\s1, \s2) {
   loop ( my $offset = 0, my \S1 = $ = '' ; ; $offset++ ) {
      S1 = s1.substr: $offset ;
      with S1.index(s2.substr(0,1)) -> $p { $offset += $p } else { return False }
      return s1.chars - $offset if s2.starts-with: s1.substr: $offset
   }
}

sub deduplicate {
   my @sorted = @_.unique.sort: *.chars; # by length   
   gather while ( my $target = shift @sorted ) {
      take $target unless @sorted.grep: { .contains: $target }  
   }
}

sub shortestCommonSuperstring {
   my \ß = $ = [~] my @ss = deduplicate @_ ;           # ShortestSuper
   for @ss.permutations -> @perm {
      my \sup = $ = @perm[0];
      for @perm.rotor(2 => -1) { sup ~= @_[1].substr: stringCentipede |@_ }
      ß = sup if sup.chars < ß.chars ;
   }
   ß
}

.&shortestCommonSuperstring.&printCounts for ( 

   <TA AAG TA GAA TA>,

   <CATTAGGG ATTAG GGG TA>,

   <AAGAUGGA GGAGCGCAUC AUCGCAAUAAGGA> ,

   <ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT 
    GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT
    CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
    TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC
    AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
    GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC
    CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT
    TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC
    CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC
    GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT
    TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC
    CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
    TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA
   >,
)
Output:

Nucleotide counts for TAAGAA :
(T 1 A 4 G 1) and total length = 6

Nucleotide counts for CATTAGGG :
(G 3 A 2 T 2 C 1) and total length = 8

Nucleotide counts for AAGAUGGAGCGCAUCGCAAUAAGGA :
(A 10 U 3 C 4 G 8) and total length = 25

Nucleotide counts for CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA :
(C 57 G 75 A 74 T 94) and total length = 300

Wren[edit]

Translation of: Julia
Library: Wren-fmt
Library: Wren-seq
Library: Wren-str
Library: Wren-math
import "/fmt" for Fmt
import "/seq" for Lst
import "/str" for Str
import "/math" for Int

/* Gets all permutations of a list of strings. */
var getPerms = Fn.new { |input|
    var perms = [input]
    var a = input.toList
    var n = a.count - 1
    for (c in 1...Int.factorial(n+1)) {
        var i = n - 1
        var j = n
        while (Str.gt(a[i], a[i+1])) i = i - 1
        while (Str.lt(a[j], a[i]))   j = j - 1
        var t = a[i]
        a[i] = a[j]
        a[j] = t
        j = n
        i = i + 1
        while (i < j) {
            t = a[i]
            a[i] = a[j]
            a[j] = t
            i = i + 1
            j = j - 1
        }
        perms.add(a.toList)
    }
    return perms
}

/* Given a DNA sequence, report the sequence, length and base counts. */
var printCounts = Fn.new { |seq|
    var bases = [["A", 0], ["C", 0], ["G", 0], ["T", 0]]
    for (c in seq) {
        for (base in bases) {
            if (c == base[0]) base[1] = base[1] + 1
        }
    }
    System.print("\nNucleotide counts for %(seq):\n")
    for (base in bases) Fmt.print("$10s$12d", base[0], base[1])
    var sum = bases.reduce(0) { |acc, x| acc + x[1] }
    Fmt.print("$10s$12d", "Other", seq.count - sum)
    Fmt.print("  ____________________\n$14s$8d", "Total length", seq.count)
}

/* Return the position in s1 of the start of overlap of tail of string s1 with head of string s2. */
var headTailOverlap = Fn.new { |s1, s2|
    var start = 0
    while (true) {
        start = s1.indexOf(s2[0], start)
        if (start == -1) return 0
        if (s2.startsWith(s1[start..-1])) return s1.count - start
        start = start + 1
    }
}

/* Remove duplicates and strings contained within a larger string from a list of strings. */
var deduplicate = Fn.new { |slist|
    var filtered = []
    var arr = Lst.distinct(slist)
    var i = 0
    for (s1 in arr) {
        var j = 0
        var withinLarger = false
        for (s2 in arr) {
            if (j != i && s2.contains(s1)) {
                withinLarger = true
                break
            }
            j = j + 1
        }
        if (!withinLarger) filtered.add(s1)
        i = i + 1
    }
    return filtered
}

/* Returns shortest common superstring of a list of strings. */
var shortestCommonSuperstring = Fn.new { |slist|
    var ss = deduplicate.call(slist)
    var shortestSuper = ss.join()
    for (perm in getPerms.call(ss)) {
        var sup = perm[0]
        for (i in 0...ss.count-1) {
            var overlapPos = headTailOverlap.call(perm[i], perm[i+1])
            sup = sup + perm[i+1][overlapPos..-1]
        }
        if (sup.count < shortestSuper.count) shortestSuper = sup
    }
    return shortestSuper
}

var testSequences = [
    ["TA", "AAG", "TA", "GAA", "TA"],
    ["CATTAGGG", "ATTAG", "GGG", "TA"],
    ["AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA"],
    [
        "ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT",
        "GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT",
        "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
        "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
        "AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT",
        "GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC",
        "CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT",
        "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
        "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC",
        "GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT",
        "TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
        "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
        "TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA"
    ]
]

for (test in testSequences) {
    var scs = shortestCommonSuperstring.call(test)
    printCounts.call(scs)
}
Output:
Nucleotide counts for TAAGAA:

         A           4
         C           0
         G           1
         T           1
     Other           0
  ____________________
  Total length       6

Nucleotide counts for CATTAGGG:

         A           2
         C           1
         G           3
         T           2
     Other           0
  ____________________
  Total length       8

Nucleotide counts for AAGAUGGAGCGCAUCGCAAUAAGGA:

         A          10
         C           4
         G           8
         T           0
     Other           3
  ____________________
  Total length      25

Nucleotide counts for CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA:

         A          74
         C          57
         G          75
         T          94
     Other           0
  ____________________
  Total length     300