Knuth-Morris-Pratt string search: Difference between revisions
Knuth-Morris-Pratt string search (view source)
Revision as of 11:53, 12 December 2023
, 5 months ago→{{header|Wren}}: Changed to Wren S/H
mNo edit summary |
m (→{{header|Wren}}: Changed to Wren S/H) |
||
| (21 intermediate revisions by 15 users not shown) | |||
Line 1:
{{draft task}}
[https://en.wikipedia.org/wiki/Knuth%E2%80%93Morris%E2%80%93Pratt_algorithm < About Knuth-Morris-Pratt String Search Algorithm >]
=={{header|
{{trans|Python}}
<syntaxhighlight lang="11l">F kmp_table(String word) -> [Int]
V position = 1
V candidate = 0
V table = [0] * (word.len + 1)
table[0] = -1
L position < word.len
I word[position] == word[candidate]
table[position] = table[candidate]
E
table[position] = candidate
L candidate >= 0 & word[position] != word[candidate]
candidate = table[candidate]
position++
candidate++
table[position] = candidate
R table
F kmp_search(String text, word)
V text_position = 0
V word_position = 0
[Int] positions
V number_of_positions = 0
V table = kmp_table(word)
L text_position < text.len
I word[word_position] == text[text_position]
text_position++
word_position++
I word_position == word.len
positions.append(text_position - word_position)
number_of_positions++
word_position = table[word_position]
E
word_position = table[word_position]
I word_position < 0
text_position++
word_position++
R (positions, number_of_positions)
V TEST_CASES = [(‘GCTAGCTCTACGAGTCTA’, ‘TCTA’),
(‘GGCTATAATGCGTA’, ‘TAATAAA’),
(‘there would have been a time for such a word’, ‘word’),
(‘needle need noodle needle’, ‘needle’),
(‘InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesley’""
‘DKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeand’""
‘assemblylanguagestoillustratetheconceptsandalgorithmsastheyare’""
‘presented’, ‘put’),
(‘InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesley’""
‘DKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeand’""
‘assemblylanguagestoillustratetheconceptsandalgorithmsastheyare’""
‘presented’, ‘and’),
(‘Nearby farms grew a half acre of alfalfa on the dairy's behalf, ’""
‘with bales of all that alfalfa exchanged for milk.’, ‘alfalfa’)]
L(text, word) TEST_CASES
V (positions, number_of_positions) = kmp_search(text, word)
I number_of_positions == 0
print(‘`’word‘` not found in `’text[0.<10]‘...`’)
E I number_of_positions == 1
print(‘Found `’word‘` in `’text[0.<10]‘...` once at ’positions‘.’)
E
print(‘Found `’word‘` in `’text[0.<10]‘...` ’number_of_positions‘ times at ’positions‘.’)</syntaxhighlight>
{{out}}
<pre>Found `TCTA` in `GCTAGCTCTA...` 2 times at [6, 14].
`TAATAAA` not found in `GGCTATAATG...`
Found `word` in `there woul...` once at [40].
Found `needle` in `needle nee...` 2 times at [0, 19].
Found `put` in `Inhisbooks...` 2 times at [26, 90].
Found `and` in `Inhisbooks...` 3 times at [101, 128, 171].
Found `alfalfa` in `Nearby far...` 2 times at [33, 87].</pre>
=={{header|Emacs Lisp}}==
<syntaxhighlight lang="lisp">
(defun kmp_compile_pattern (pattern)
"Compile pattern to DFA."
Line 43 ⟶ 122:
(setq textPos (1+ textPos)) )
(if (= patPos M) (- textPos M) N ) ) ) )</syntaxhighlight>
=={{header|Fortran}}==
<syntaxhighlight lang="Fortran">
module kmp_mod
use iso_fortran_env
implicit none
private
public :: kmpsearch
contains
!This subroutine creates the "fail" table used for the KMP algorithm
pure subroutine createtable(pattern,patlen,table)
implicit none
!
! Dummy arguments
!
integer :: patlen
character(*) :: pattern
integer , dimension(:) :: table
intent (in) patlen , pattern
intent (inout) table
!
! Local variables
!
integer :: counter
integer :: i
integer :: j
!*Code
counter=2
i=1
j=0
!Determine the table/fail value for each letter in the pattern
do i=1 , patlen
j=i
do
! If j is equal to zero, then there is no offset/fail value required. Therefore, just set the fail value to 0
if( j==1 )then
table(counter)=1
counter=counter+1
exit
end if
! If a match is made, the fail value can be imcremented by one (based off the fail value of the previous character in the pattern)
if( pattern(table(j):table(j))==pattern(i:i) )then
table(counter)=table(j)+1
counter=counter+1
exit
end if
! If neither if statement is true, restart the fail value counter
j=table(j)
end do
end do
end subroutine createtable
! This subroutine executes the string search using the KMP algorithm (fail table)
pure function kmpsearch(pattern,patlen,line,linelen) &
& result(foundmatch)
implicit none
!
! Dummy arguments
!
character(*) :: line
integer :: linelen
integer :: patlen
character(*) :: pattern
intent (in) line , linelen , patlen , pattern
!
! Local variables
!
integer :: foundmatch
integer :: indice
integer :: match
integer , dimension(256) :: table
!*Code
if( (patlen==0) .or. (linelen==0) .or. (linelen<patlen) )then
foundmatch=-1
return
end if
indice=1
match=0
foundmatch=-1
call createtable(pattern,patlen,table)
!Search the entire string
do while ( indice+match<=linelen )
if( match+1<patlen+1 )then
! If the character matches the character we are expecting (based on where in the pattern we have already matched characters with) increment the match indice
if( line(indice+match:indice+match)==pattern(match+1:match+1) )then
match=match+1
! If the match indice is equal to the length of the pattern, that means we have matched the entire pattern
if( match==patlen )then
foundmatch=indice !-1
exit !Found
end if
!Look at the table to determine what indice to check next
! If no match was made on the first letter of the pattern, then just increment the indice counter by one and check again
else if( match==0 )then
indice=indice+1
! Check how many characters to skip ahead (the point of the KMP algorithm)
else
indice=indice+match+1-table(match+1)
match=table(match+1)-1
end if
! If no match was made after scanning the length of the pattern, need increment the indice counter and check again
else if( match==0 )then
indice=indice+1 !Not even a partial match, try next character
else !Check how many characters to skip ahead (the point of the KMP algorithm)
indice=indice+match+1-table(match+1)
match=table(match+1)-1
end if
end do
! 'No match found'
return
end function kmpsearch
end module kmp_mod</syntaxhighlight>
=={{header|FreeBASIC}}==
'''Adapted from [[#Wren|Wren]]'''
<syntaxhighlight lang="vb">Dim Shared As Integer t()
Dim Shared As Integer indices()
Sub Tabla(patron As String)
Dim As Integer nc = Len(patron)
Redim As Integer t(nc)
Dim As Integer idx = 1 ' index into table
Dim As Integer lon = 0 ' length of previous longest prefix
While idx < nc
If patron[idx] = patron[lon] Then
lon += 1
t(idx) = lon
idx += 1
Elseif lon <> 0 Then
lon = t(lon-1)
Else
t(idx) = 0
idx += 1
End If
Wend
End Sub
Sub BusquedaKMP(texto As String, patron As String)
Dim As Integer hc = Len(texto)
Dim As Integer nc = Len(patron)
Dim As Integer i = 0 ' index into haystack
Dim As Integer j = 0 ' index into needle
Dim As Integer cont = 1
Tabla(patron)
While i < hc
If patron[j] = texto[i] Then
i += 1
j += 1
End If
If j = nc Then
Redim Preserve indices(cont)
indices(cont) = (i - j)
cont += 1
j = t(j-1)
Elseif i < hc And patron[j] <> texto[i] Then
If j <> 0 Then j = t(j-1) Else i += 1
End If
Wend
End Sub
Dim As Integer i, j, k
Dim As String cadenas(1 To 6) = {"GCTAGCTCTACGAGTCTA", "GGCTATAATGCGTA", _
"there would have been a time for such a word", "needle need noodle needle", _
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented", _
"Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk."}
Dim As String palabra(1 To 7) = { _
"TCTA", "TAATAAA", "word", "needle", "put", "and", "alfalfa"}
For i = 1 To Ubound(cadenas)
Print Using "text# = &"; i; cadenas(i)
Next
Print
For i = 1 To Ubound(palabra)
j = Iif(i < 6, i, i-1)
Print Using "Found '&' in 'text#' at indices [ "; palabra(i); j;
BusquedaKMP(cadenas(j), palabra(i))
If Ubound(indices) > 0 Then
For k = 1 To Ubound(indices)
Print indices(k) & ", ";
Next
Else
Print " ";
End If
Print Chr(8) & Chr(8) & " ]"
Erase indices
Next
Sleep</syntaxhighlight>
{{out}}
<pre>text1 = GCTAGCTCTACGAGTCTA
text2 = GGCTATAATGCGTA
text3 = there would have been a time for such a word
text4 = needle need noodle needle
text5 = InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented
text6 = Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk.
Found 'TCTA' in 'text1' at indices [ 6, 14 ]
Found 'TAATAAA' in 'text2' at indices [ ]
Found 'word' in 'text3' at indices [ 40 ]
Found 'needle' in 'text4' at indices [ 0, 19 ]
Found 'put' in 'text5' at indices [ 26, 90 ]
Found 'and' in 'text5' at indices [ 101, 128, 171 ]
Found 'alfalfa' in 'text6' at indices [ 33, 87 ]</pre>
=={{header|J}}==
Implementation:<syntaxhighlight lang="j">kmp_table=: {{
j=. 0
T=. _1
for_ch. }.y do.
if. ch=j{y do.
T=. T,j{T
else.
T=. T,j while. (0<:j) * ch~:j{y do. j=. j{T end.
end.
j=. j+1
end.
T=. T, j
}}
kmp_search=: {{
b=. 0#~#y
k=. _1
f=. _1+#x
T=. kmp_table x
for_ch. y do.
if. ch=x{~k=.k+1 do.
if. f=k do.
b=. 1 (ch_index-k)} b
k=. k{T
end.
else.
whilst. _1<k do.
if. ch=x{~k=. k{T do. break. end.
end.
end.
end.
I. b
}}</syntaxhighlight>
Task examples:<syntaxhighlight lang="j"> text1=: 'InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented'
text2=: 'Nearby farms grew a half acre of alfalfa on the dairy''s behalf, with bales of all that alfalfa exchanged for milk.'
'put' kmp_search text1
26 90
'and' kmp_search text1
101 128 171
'and' kmp_search text2
'alfalfa' kmp_search text2
33 87</syntaxhighlight>
(J uses index 0 for the first character in a sequence of characters.)
=={{header|jq}}==
'''Adapted from [[#Wren|Wren]]'''
{{Works with|jq}}
The program will also work with gojq once the prefix "KMP::" is
omitted in the two lines in which it occurs.
<syntaxhighlight lang=jq># search for the string needle in the string haystack
def KMP::search(haystack; needle):
def table_($needle):
($needle|length) as $nc
| {t: [range(0; $nc) | 0],
i: 1, # index into table
len: 0 # length of previous longest prefix
}
| until(.i >= .nc;
if $needle[.i] == $needle[.len]
then .len += 1
| .t[.i] = .len
| .i += 1
elif .len != 0
then .len = .t[.len-1]
else .t[.i] = 0
| .i += 1
end )
| .t ;
{ haystack: (haystack|explode),
needle: (needle|explode),
hc: (haystack|length),
nc: (needle|length),
indices: [],
i: 0, # index into haystack
j: 0 # index into needle
}
| table_(.needle) as $t
| until (.i >= .hc;
if .needle[.j] == .haystack[.i]
then .i += 1
| .j += 1
else .
end
| if .j == .nc
then .indices = .indices + [.i - .j]
| .j = $t[.j-1]
elif (.i < .hc and .needle[.j] != .haystack[.i])
then if .j != 0 then .j = $t[.j-1] else .i += 1 end
else .
end )
| .indices ;
# Examples
def texts: [
"GCTAGCTCTACGAGTCTA",
"GGCTATAATGCGTA",
"there would have been a time for such a word",
"needle need noodle needle",
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented",
"Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk."
];
def pats: ["TCTA", "TAATAAA", "word", "needle", "put", "and", "alfalfa"];
def tasks($texts; $pats):
range (0; $texts|length) | "text\(.+1) = \($texts[.])",
"",
(range (0; $pats|length) as $i
| (if $i < 5 then $i else $i-1 end) as $j
| "Found '\($pats[$i])' in text\($j+1) at indices \(KMP::search($texts[$j]; $pats[$i]) )" ) ;
tasks(texts; pats)</syntaxhighlight>
'''Invocation''': jq -nr -f kmp-string-search.jq
{{output}}
<pre>text1 = GCTAGCTCTACGAGTCTA
text2 = GGCTATAATGCGTA
text3 = there would have been a time for such a word
text4 = needle need noodle needle
text5 = InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented
text6 = Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk.
Found 'TCTA' in text1 at indices [6, 14]
Found 'TAATAAA' in text2 at indices []
Found 'word' in text3 at indices [40]
Found 'needle' in text4 at indices [0, 19]
Found 'put' in text5 at indices [26, 90]
Found 'and' in text5 at indices [101, 128, 171]
Found 'alfalfa' in text6 at indices [33, 87]</pre>
=={{header|Julia}}==
<syntaxhighlight lang="julia">"""
function kmp_table(W)
input:
an array of characters, W (the word to be analyzed)
output:
an array of integers, T (the table to be filled)
define variables:
an integer, i ← 2 (the current one-based position we are computing in T)
an integer, j ← 0 (the additive to index i in W of the next character of the current candidate substring)
"""
function kmp_table(W)
len = length(W)
T = zeros(Int, len)
# start with the second letter of W, looking for patterns in W
i = 2
while i < len
j = 0
while i + j <= len # avoid overshooting end with index
# compute the longest proper prefix
if W[i + j] == W[j + 1]
T[i + j] = T[i + j - 1] + 1
else
T[i + j] = 0 # back to start
j += 1
break
end
j += 1
end
# entry in T found, so begin at next starting point along W
i += j
end
return T
end
"""
function kmp_search(S, W)
input:
an array of characters, S (the text to be searched)
an array of characters, W (the word sought)
output:
an array of integers, P (positions in S at which W is found)
define variables (one based indexing in Julia differs from the Wikipedia example):
an integer, i ← 1 (the position of the current character in S)
an integer, j ← 1 (the position of the current character in W)
an array of integers, T (the table, computed elsewhere)
"""
function kmp_search(S, W)
lenW, lenS = length(W), length(S)
i, P = 1, Int[]
T = kmp_table(W) # get pattern table
while i <= lenS - lenW + 1
for j in 1:lenW
if S[i + j - 1] != W[j]
# pattern not found, so skip unnecessary inner loops
i += T[j] + 1
@goto next_outer_loop
end
end
# found pattern W in S, so add to output P
push!(P, i)
i += 1
@label next_outer_loop
end
return P
end
const text1 = "InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented"
const text2 = "Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk."
const pat1, pat2, pat3 = "put", "and", "alfalfa"
println("Found <$pat1> at: (one-based indices) ", kmp_search(text1, pat1))
println("Found <$pat2> at: (one-based indices) ", kmp_search(text1, pat2))
println("Found <$pat3> at: (one-based indices) ", kmp_search(text2, pat3))
</syntaxhighlight>{{out}}
<pre>Found <put> at: (one-based indices) [27, 91]
Found <and> at: (one-based indices) [102, 129, 172]
Found <alfalfa> at: (one-based indices) [34, 88]</pre>
=={{header|Nim}}==
This is a translation of pseudocode in Wikipedia page. We use the examples of Wren solution.
<syntaxhighlight lang="Nim">import std/[strformat, strutils]
func kmpTable(w: string): seq[int] =
## Build the partial match table for "w".
result.setLen w.len + 1
var pos = 1
var cnd = 0
result[0] = -1
while pos < w.len:
if w[pos] == w[cnd]:
result[pos] = result[cnd]
else:
result[pos] = cnd
while cnd >= 0 and w[pos] != w[cnd]:
cnd = result[cnd]
inc pos
inc cnd
result[pos] = cnd
func kmpSearch(s, w: string): seq[int] =
## Return the positions of "w" ins "s".
var j, k = 0
let t = kmpTable(w)
while j < s.len:
if w[k] == s[j]:
inc j
inc k
if k == w.len:
result.add j - k
k = t[k]
else:
k = t[k]
if k < 0:
inc j
inc k
const
Texts = ["GCTAGCTCTACGAGTCTA",
"GGCTATAATGCGTA",
"there would have been a time for such a word",
"needle need noodle needle",
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuth" &
"usesanimaginarycomputertheMIXanditsassociatedmachinecodeandassembly" &
"languagestoillustratetheconceptsandalgorithmsastheyarepresented",
"Nearby farms grew a half acre of alfalfa on the dairy's behalf, " &
"with bales of all that alfalfa exchanged for milk."
]
# Couples (pattern, index of text to use).
Patterns = {"TCTA": 0, "TAATAAA": 1, "word": 2, "needle": 3, "put": 4, "and": 4, "alfalfa": 5}
for i, text in Texts:
echo &"Text{i+1} = {text}"
echo()
for i, (pattern, j) in Patterns:
let indices = Texts[j].kmpSearch(pattern)
if indices.len > 0:
echo &"Found “{pattern}” in “Text{j+1}” at indices {indices.join(\", \")}."
else:
echo &"Not found “{pattern}” in “Text{j+1}”."
</syntaxhighlight>
{{out}}
<pre>Text1 = GCTAGCTCTACGAGTCTA
Text2 = GGCTATAATGCGTA
Text3 = there would have been a time for such a word
Text4 = needle need noodle needle
Text5 = InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented
Text6 = Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk.
Found “TCTA” in “Text1” at indices 6, 14.
Not found “TAATAAA” in “Text2”.
Found “word” in “Text3” at indices 40.
Found “needle” in “Text4” at indices 0, 19.
Found “put” in “Text5” at indices 26, 90.
Found “and” in “Text5” at indices 101, 128, 171.
Found “alfalfa” in “Text6” at indices 33, 87.</pre>
=={{header|Perl}}==
{{trans|Raku}}
<syntaxhighlight lang="perl" line>use v5.36;
sub kmp_search ($S, $W) {
my @S = split '', $S;
my @W = split '', $W;
sub kmp_table (@W) {
my($pos,$cnd,@T) = (1,0,-1);
for (; $pos < @W ; $pos++, $cnd++) {
if ($W[$pos] eq $W[$cnd]) {
$T[$pos] = $T[$cnd]
} else {
$T[$pos] = $cnd;
while ($cnd >= 0 and $W[$pos] ne $W[$cnd]) { $cnd = $T[$cnd] }
}
}
$T[$pos] = $cnd;
@T
}
my @I;
my ($k,@T) = (0,kmp_table @W);
for (my $j=0; $j < @S;) {
if ($W[$k] eq $S[$j]) {
$j++; $k++;
if ($k == @W) {
push @I, $j - $k;
$k = $T[$k]
}
} else {
($j++, $k++) if ($k = $T[$k]) < 0
}
}
@I
}
my @texts = (
"GCTAGCTCTACGAGTCTA",
"GGCTATAATGCGTA",
"there would have been a time for such a word",
"needle need noodle needle",
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented",
"Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk.",
);
my @pats = <TCTA TAATAAA word needle put and alfalfa>;
say "text$_ = $texts[$_]" for 0..$#texts;
say '';
for (0.. $#pats) {
my $j = $_ < 5 ? $_ : $_-1 ; # for searching text4 twice
say "Found '$pats[$_]' in 'text$j' at indices " . join ', ', kmp_search($texts[$j],$pats[$_]);
}</syntaxhighlight>
{{out}}
<pre>text0 = GCTAGCTCTACGAGTCTA
text1 = GGCTATAATGCGTA
text2 = there would have been a time for such a word
text3 = needle need noodle needle
text4 = InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented
text5 = Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk.
Found 'TCTA' in 'text0' at indices 6, 14
Found 'TAATAAA' in 'text1' at indices
Found 'word' in 'text2' at indices 40
Found 'needle' in 'text3' at indices 0, 19
Found 'put' in 'text4' at indices 26, 90
Found 'and' in 'text4' at indices 101, 128, 171
Found 'alfalfa' in 'text5' at indices 33, 87</pre>
=={{header|Phix}}==
<!--<syntaxhighlight lang="phix">(phixonline)-->
<span style="color: #000080;font-style:italic;">--
-- demo\rosetta\KnuthMorrisPratt.exw
-- =================================
--
-- based on https://www-igm.univ-mlv.fr/~lecroq/string/node8.html#SECTION0080
--</span>
<span style="color: #008080;">with</span> <span style="color: #008080;">javascript_semantics</span>
<span style="color: #008080;">function</span> <span style="color: #000000;">preKmp</span><span style="color: #0000FF;">(</span><span style="color: #004080;">string</span> <span style="color: #000000;">pat</span><span style="color: #0000FF;">)</span>
<span style="color: #004080;">integer</span> <span style="color: #000000;">m</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">length</span><span style="color: #0000FF;">(</span><span style="color: #000000;">pat</span><span style="color: #0000FF;">),</span> <span style="color: #000000;">i</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">1</span><span style="color: #0000FF;">,</span> <span style="color: #000000;">j</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">0</span>
<span style="color: #004080;">sequence</span> <span style="color: #000000;">kmpNext</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">repeat</span><span style="color: #0000FF;">(-</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #000000;">m</span><span style="color: #0000FF;">+</span><span style="color: #000000;">1</span><span style="color: #0000FF;">)</span>
<span style="color: #000000;">pat</span> <span style="color: #0000FF;">&=</span> <span style="color: #008000;">'\0'</span>
<span style="color: #008080;">while</span> <span style="color: #000000;">i</span> <span style="color: #0000FF;"><=</span> <span style="color: #000000;">m</span> <span style="color: #008080;">do</span>
<span style="color: #008080;">while</span> <span style="color: #000000;">j</span> <span style="color: #0000FF;">></span> <span style="color: #000000;">0</span> <span style="color: #008080;">and</span> <span style="color: #000000;">pat</span><span style="color: #0000FF;">[</span><span style="color: #000000;">i</span><span style="color: #0000FF;">]</span> <span style="color: #0000FF;">!=</span> <span style="color: #000000;">pat</span><span style="color: #0000FF;">[</span><span style="color: #000000;">j</span><span style="color: #0000FF;">]</span> <span style="color: #008080;">do</span>
<span style="color: #000000;">j</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">kmpNext</span><span style="color: #0000FF;">[</span><span style="color: #000000;">j</span><span style="color: #0000FF;">]+</span><span style="color: #000000;">1</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">while</span>
<span style="color: #000000;">i</span> <span style="color: #0000FF;">+=</span> <span style="color: #000000;">1</span>
<span style="color: #000000;">j</span> <span style="color: #0000FF;">+=</span> <span style="color: #000000;">1</span>
<span style="color: #008080;">if</span> <span style="color: #000000;">pat</span><span style="color: #0000FF;">[</span><span style="color: #000000;">i</span><span style="color: #0000FF;">]</span> <span style="color: #0000FF;">==</span> <span style="color: #000000;">pat</span><span style="color: #0000FF;">[</span><span style="color: #000000;">j</span><span style="color: #0000FF;">]</span> <span style="color: #008080;">then</span>
<span style="color: #000000;">kmpNext</span><span style="color: #0000FF;">[</span><span style="color: #000000;">i</span><span style="color: #0000FF;">]</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">kmpNext</span><span style="color: #0000FF;">[</span><span style="color: #000000;">j</span><span style="color: #0000FF;">]</span>
<span style="color: #008080;">else</span>
<span style="color: #000000;">kmpNext</span><span style="color: #0000FF;">[</span><span style="color: #000000;">i</span><span style="color: #0000FF;">]</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">j</span><span style="color: #0000FF;">-</span><span style="color: #000000;">1</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">if</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">while</span>
<span style="color: #008080;">return</span> <span style="color: #000000;">kmpNext</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">function</span>
<span style="color: #008080;">procedure</span> <span style="color: #000000;">KMP</span><span style="color: #0000FF;">(</span><span style="color: #004080;">string</span> <span style="color: #000000;">pat</span><span style="color: #0000FF;">,</span> <span style="color: #000000;">s</span><span style="color: #0000FF;">,</span> <span style="color: #004080;">bool</span> <span style="color: #000000;">case_insensitive</span> <span style="color: #0000FF;">=</span> <span style="color: #004600;">false</span><span style="color: #0000FF;">)</span>
<span style="color: #004080;">string</span> <span style="color: #000000;">pins</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">sprintf</span><span style="color: #0000FF;">(</span><span style="color: #008000;">"`%s` in `%s`"</span><span style="color: #0000FF;">,{</span><span style="color: #000000;">pat</span><span style="color: #0000FF;">,</span><span style="color: #7060A8;">shorten</span><span style="color: #0000FF;">(</span><span style="color: #000000;">s</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"characters"</span><span style="color: #0000FF;">,</span><span style="color: #000000;">10</span><span style="color: #0000FF;">)})</span>
<span style="color: #008080;">if</span> <span style="color: #000000;">case_insensitive</span> <span style="color: #008080;">then</span> <span style="color: #0000FF;">{</span><span style="color: #000000;">pat</span><span style="color: #0000FF;">,</span><span style="color: #000000;">s</span><span style="color: #0000FF;">}</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">lower</span><span style="color: #0000FF;">({</span><span style="color: #000000;">pat</span><span style="color: #0000FF;">,</span><span style="color: #000000;">s</span><span style="color: #0000FF;">})</span> <span style="color: #008080;">end</span> <span style="color: #008080;">if</span>
<span style="color: #000080;font-style:italic;">/* Preprocessing */</span>
<span style="color: #004080;">sequence</span> <span style="color: #000000;">kmpNext</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">preKmp</span><span style="color: #0000FF;">(</span><span style="color: #000000;">pat</span><span style="color: #0000FF;">)</span>
<span style="color: #000080;font-style:italic;">/* Searching */</span>
<span style="color: #004080;">sequence</span> <span style="color: #000000;">res</span> <span style="color: #0000FF;">=</span> <span style="color: #0000FF;">{}</span>
<span style="color: #004080;">integer</span> <span style="color: #000000;">i</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">0</span><span style="color: #0000FF;">,</span> <span style="color: #000000;">j</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">0</span><span style="color: #0000FF;">,</span>
<span style="color: #000000;">n</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">length</span><span style="color: #0000FF;">(</span><span style="color: #000000;">s</span><span style="color: #0000FF;">),</span>
<span style="color: #000000;">m</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">length</span><span style="color: #0000FF;">(</span><span style="color: #000000;">pat</span><span style="color: #0000FF;">),</span>
<span style="color: #000000;">cc</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">0</span>
<span style="color: #008080;">while</span> <span style="color: #000000;">j</span> <span style="color: #0000FF;"><</span> <span style="color: #000000;">n</span> <span style="color: #008080;">do</span>
<span style="color: #008080;">while</span> <span style="color: #000000;">i</span> <span style="color: #0000FF;">></span> <span style="color: #0000FF;">-</span><span style="color: #000000;">1</span> <span style="color: #008080;">do</span>
<span style="color: #000000;">cc</span> <span style="color: #0000FF;">+=</span> <span style="color: #000000;">1</span>
<span style="color: #008080;">if</span> <span style="color: #000000;">pat</span><span style="color: #0000FF;">[</span><span style="color: #000000;">i</span><span style="color: #0000FF;">+</span><span style="color: #000000;">1</span><span style="color: #0000FF;">]</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">s</span><span style="color: #0000FF;">[</span><span style="color: #000000;">j</span><span style="color: #0000FF;">+</span><span style="color: #000000;">1</span><span style="color: #0000FF;">]</span> <span style="color: #008080;">then</span> <span style="color: #008080;">exit</span> <span style="color: #008080;">end</span> <span style="color: #008080;">if</span>
<span style="color: #000000;">i</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">kmpNext</span><span style="color: #0000FF;">[</span><span style="color: #000000;">i</span><span style="color: #0000FF;">+</span><span style="color: #000000;">1</span><span style="color: #0000FF;">]</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">while</span>
<span style="color: #000000;">i</span> <span style="color: #0000FF;">+=</span> <span style="color: #000000;">1</span>
<span style="color: #000000;">j</span> <span style="color: #0000FF;">+=</span> <span style="color: #000000;">1</span>
<span style="color: #008080;">if</span> <span style="color: #000000;">i</span> <span style="color: #0000FF;">>=</span> <span style="color: #000000;">m</span> <span style="color: #008080;">then</span>
<span style="color: #000000;">res</span> <span style="color: #0000FF;">&=</span> <span style="color: #000000;">j</span><span style="color: #0000FF;">-</span><span style="color: #000000;">i</span><span style="color: #0000FF;">+</span><span style="color: #000000;">1</span>
<span style="color: #000000;">i</span> <span style="color: #0000FF;">=</span> <span style="color: #000000;">kmpNext</span><span style="color: #0000FF;">[</span><span style="color: #000000;">i</span><span style="color: #0000FF;">+</span><span style="color: #000000;">1</span><span style="color: #0000FF;">]</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">if</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">while</span>
<span style="color: #000080;font-style:italic;">/* Output */</span>
<span style="color: #004080;">string</span> <span style="color: #000000;">ccs</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">sprintf</span><span style="color: #0000FF;">(</span><span style="color: #008000;">"(%d character comparisons)"</span><span style="color: #0000FF;">,</span><span style="color: #000000;">cc</span><span style="color: #0000FF;">)</span>
<span style="color: #008080;">if</span> <span style="color: #7060A8;">length</span><span style="color: #0000FF;">(</span><span style="color: #000000;">res</span><span style="color: #0000FF;">)</span> <span style="color: #008080;">then</span>
<span style="color: #004080;">string</span> <span style="color: #000000;">many</span> <span style="color: #0000FF;">=</span> <span style="color: #7060A8;">ordinant</span><span style="color: #0000FF;">(</span><span style="color: #7060A8;">length</span><span style="color: #0000FF;">(</span><span style="color: #000000;">res</span><span style="color: #0000FF;">))</span>
<span style="color: #7060A8;">printf</span><span style="color: #0000FF;">(</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"Found %s %s at %v %s\n"</span><span style="color: #0000FF;">,{</span><span style="color: #000000;">pins</span><span style="color: #0000FF;">,</span><span style="color: #000000;">many</span><span style="color: #0000FF;">,</span><span style="color: #000000;">res</span><span style="color: #0000FF;">,</span><span style="color: #000000;">ccs</span><span style="color: #0000FF;">})</span>
<span style="color: #008080;">else</span>
<span style="color: #7060A8;">printf</span><span style="color: #0000FF;">(</span><span style="color: #000000;">1</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"No %s %s\n"</span><span style="color: #0000FF;">,{</span><span style="color: #000000;">pins</span><span style="color: #0000FF;">,</span><span style="color: #000000;">ccs</span><span style="color: #0000FF;">})</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">if</span>
<span style="color: #008080;">end</span> <span style="color: #008080;">procedure</span>
<span style="color: #000000;">KMP</span><span style="color: #0000FF;">(</span><span style="color: #008000;">"GCAGAGAG"</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"GCATCGCAGAGAGTATACAGTACG"</span><span style="color: #0000FF;">)</span>
<span style="color: #000000;">KMP</span><span style="color: #0000FF;">(</span><span style="color: #008000;">"TCTA"</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"GCTAGCTCTACGAGTCTA"</span><span style="color: #0000FF;">)</span>
<span style="color: #000000;">KMP</span><span style="color: #0000FF;">(</span><span style="color: #008000;">"TAATAAA"</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"GGCTATAATGCGTA"</span><span style="color: #0000FF;">)</span>
<span style="color: #000000;">KMP</span><span style="color: #0000FF;">(</span><span style="color: #008000;">"word"</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"there would have been a time for such a word"</span><span style="color: #0000FF;">)</span>
<span style="color: #000000;">KMP</span><span style="color: #0000FF;">(</span><span style="color: #008000;">"needle"</span><span style="color: #0000FF;">,</span><span style="color: #008000;">"needle need noodle needle"</span><span style="color: #0000FF;">)</span>
<span style="color: #008080;">constant</span> <span style="color: #000000;">book</span> <span style="color: #0000FF;">=</span> <span style="color: #008000;">"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesley"</span><span style="color: #0000FF;">&</span>
<span style="color: #008000;">"DKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeand"</span><span style="color: #0000FF;">&</span>
<span style="color: #008000;">"assemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented"</span>
<span style="color: #000000;">KMP</span><span style="color: #0000FF;">(</span><span style="color: #008000;">"put"</span><span style="color: #0000FF;">,</span><span style="color: #000000;">book</span><span style="color: #0000FF;">)</span>
<span style="color: #000000;">KMP</span><span style="color: #0000FF;">(</span><span style="color: #008000;">"and"</span><span style="color: #0000FF;">,</span><span style="color: #000000;">book</span><span style="color: #0000FF;">)</span>
<span style="color: #008080;">constant</span> <span style="color: #000000;">farm</span> <span style="color: #0000FF;">=</span> <span style="color: #008000;">"Nearby farms grew a half acre of alfalfa on the dairy's behalf, with "</span><span style="color: #0000FF;">&</span>
<span style="color: #008000;">"bales of all that alfalfa exchanged for milk."</span>
<span style="color: #000000;">KMP</span><span style="color: #0000FF;">(</span><span style="color: #008000;">"alfalfa"</span><span style="color: #0000FF;">,</span><span style="color: #000000;">farm</span><span style="color: #0000FF;">)</span>
<span style="color: #000080;font-style:italic;">--KMP("aLfAlfa",farm) -- none
--KMP("aLfAlfa",farm,true) -- as -2</span>
<!--</syntaxhighlight>-->
{{out}}
Significantly higher character comparison counts than [[Boyer-Moore_string_search#Phix]].<br>
Also higher than those on the above (lecroq) link, probably because this carries on for all matches.
<pre>Found `GCAGAGAG` in `GCATCGCAGAGAGTATACAGTACG` once at {6} (26 character comparisons)
Found `TCTA` in `GCTAGCTCTACGAGTCTA` twice at {7,15} (19 character comparisons)
No `TAATAAA` in `GGCTATAATGCGTA` (16 character comparisons)
Found `word` in `there woul...uch a word (44 characters)` once at {41} (45 character comparisons)
Found `needle` in `needle need noodle needle` twice at {1,20} (27 character comparisons)
Found `put` in `Inhisbooks...epresented (202 characters)` twice at {27,91} (205 character comparisons)
Found `and` in `Inhisbooks...epresented (202 characters)` three times at {102,129,172} (216 character comparisons)
Found `alfalfa` in `Nearby far... for milk. (114 characters)` twice at {34,88} (125 character comparisons)</pre>
=={{header|Python}}==
Based on pseudocode found in the [https://en.wikipedia.org/wiki/Knuth%E2%80%93Morris%E2%80%93Pratt_algorithm Wikipedia article]. Uses test cases from the [[#Wren]] solution.
<syntaxhighlight lang="python">"""Knuth-Morris-Pratt string search. Requires Python >= 3.7."""
from typing import List
from typing import Tuple
def kmp_search(text: str, word: str) -> Tuple[List[int], int]:
text_position = 0
word_position = 0
positions: List[int] = []
number_of_positions = 0
table = kmp_table(word)
while text_position < len(text):
if word[word_position] == text[text_position]:
text_position += 1
word_position += 1
if word_position == len(word):
positions.append(text_position - word_position)
number_of_positions += 1
word_position = table[word_position]
else:
word_position = table[word_position]
if word_position < 0:
text_position += 1
word_position += 1
return positions, number_of_positions
def kmp_table(word: str) -> List[int]:
position = 1
candidate = 0
table = [0] * (len(word) + 1)
table[0] = -1
while position < len(word):
if word[position] == word[candidate]:
table[position] = table[candidate]
else:
table[position] = candidate
while candidate >= 0 and word[position] != word[candidate]:
candidate = table[candidate]
position += 1
candidate += 1
table[position] = candidate
return table
TEST_CASES = [
("GCTAGCTCTACGAGTCTA", "TCTA"),
("GGCTATAATGCGTA", "TAATAAA"),
("there would have been a time for such a word", "word"),
("needle need noodle needle", "needle"),
(
(
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesley"
"DKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeand"
"assemblylanguagestoillustratetheconceptsandalgorithmsastheyare"
"presented"
),
"put",
),
(
(
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesley"
"DKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeand"
"assemblylanguagestoillustratetheconceptsandalgorithmsastheyare"
"presented"
),
"and",
),
(
(
"Nearby farms grew a half acre of alfalfa on the dairy's behalf, "
"with bales of all that alfalfa exchanged for milk."
),
"alfalfa",
),
]
def main():
for text, word in TEST_CASES:
positions, number_of_positions = kmp_search(text, word)
if number_of_positions == 0:
print(f"`{word}` not found in `{text[:10]}...`")
elif number_of_positions == 1:
print(f"Found `{word}` in `{text[:10]}...` once at {positions}.")
else:
print(
f"Found `{word}` in `{text[:10]}...` {number_of_positions} times at {positions}."
)
if __name__ == "__main__":
main()
</syntaxhighlight>
{{out}}
<pre>Found `TCTA` in `GCTAGCTCTA...` 2 times at [6, 14].
`TAATAAA` not found in `GGCTATAATG...`
Found `word` in `there woul...` once at [40].
Found `needle` in `needle nee...` 2 times at [0, 19].
Found `put` in `Inhisbooks...` 2 times at [26, 90].
Found `and` in `Inhisbooks...` 3 times at [101, 128, 171].
Found `alfalfa` in `Nearby far...` 2 times at [33, 87].</pre>
=={{header|Raku}}==
Based on pseudocode found in WP ([https://en.wikipedia.org/wiki/Knuth%E2%80%93Morris%E2%80%93Pratt_algorithm#Description_of_pseudocode_for_the_search_algorithm kmp_search ] & [https://en.wikipedia.org/wiki/Knuth%E2%80%93Morris%E2%80%93Pratt_algorithm#Description_of_pseudocode_for_the_table-building_algorithm kmp_table]). Data and output format mostly follows the Wren entry.
<syntaxhighlight lang="raku" line># 20220810 Raku programming solution
sub kmp_search (@S where *.Bool, @W where *.Bool) {
sub kmp_table (@W where *.Bool) {
loop (my ($pos,$cnd,@T) = 1,0,-1 ; $pos < @W.elems ; ($pos, $cnd)>>++) {
if @W[$pos] eq @W[$cnd] {
@T[$pos] = @T[$cnd]
} else {
@T[$pos] = $cnd;
while $cnd ≥ 0 and @W[$pos] ne @W[$cnd] { $cnd = @T[$cnd] }
}
}
@T[$pos] = $cnd;
return @T
}
return gather loop (my ($j,$k,@T) = 0,0, |kmp_table @W; $j < @S.elems; ) {
if @W[$k] eq @S[$j] {
($j, $k)>>++;
if $k == @W.elems {
take $j - $k;
$k = @T[$k]
}
} else {
($j, $k)>>++ if ($k = @T[$k]) < 0
}
}
}
my @texts = [
"GCTAGCTCTACGAGTCTA",
"GGCTATAATGCGTA",
"there would have been a time for such a word",
"needle need noodle needle",
"BharôtভাৰতBharôtভারতIndiaBhāratભારતBhāratभारतBhārataಭಾರತBhāratभारतBhāratamഭാരതംBhāratभारतBhāratभारतBharôtôଭାରତBhāratਭਾਰਤBhāratamभारतम्Bārataபாரதம்BhāratamഭാരതംBhāratadēsamభారతదేశం",
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented",
"Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk.",
];
my @pats = ["TCTA", "TAATAAA", "word", "needle", "ഭാരതം", "put", "and", "alfalfa"];
say "text$_ = @texts[$_]" for @texts.keys ;
say();
for @pats.keys {
my \j = $_ < 6 ?? $_ !! $_-1 ; # for searching text5 twice
say "Found '@pats[$_]' in 'text{j}' at indices ", kmp_search @texts[j].comb, @pats[$_].comb
}</syntaxhighlight>
{{out}}
<pre>text0 = GCTAGCTCTACGAGTCTA
text1 = GGCTATAATGCGTA
text2 = there would have been a time for such a word
text3 = needle need noodle needle
text4 = BharôtভাৰতBharôtভারতIndiaBhāratભારતBhāratभारतBhārataಭಾರತBhāratभारतBhāratamഭാരതംBhāratभारतBhāratभारतBharôtôଭାରତBhāratਭਾਰਤBhāratamभारतम्Bārataபாரதம்BhāratamഭാരതംBhāratadēsamభారతదేశం
text5 = InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented
text6 = Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk.
Found 'TCTA' in 'text0' at indices (6 14)
Found 'TAATAAA' in 'text1' at indices ()
Found 'word' in 'text2' at indices (40)
Found 'needle' in 'text3' at indices (0 19)
Found 'ഭാരതം' in 'text4' at indices (68 138)
Found 'put' in 'text5' at indices (26 90)
Found 'and' in 'text5' at indices (101 128 171)
Found 'alfalfa' in 'text6' at indices (33 87)</pre>
=={{header|Sidef}}==
{{trans|Raku}}
<syntaxhighlight lang="ruby">func kmp_search (String S, String W) {
S.graphemes!
W.graphemes!
func kmp_table {
var (pos, cnd, *T) = (1, 0, -1)
for (nil; pos < W.len; (++pos; ++cnd)) {
if (W[pos] == W[cnd]) {
T[pos] = T[cnd]
}
else {
T[pos] = cnd
while ((cnd >= 0) && (W[pos] != W[cnd])) {
cnd = T[cnd]
}
}
}
T[pos] = cnd
return T
}
var (k, T, *I) = (0, kmp_table())
for (var j = 0; j < S.len; nil) {
if (W[k] == S[j]) {
++j
++k
if (k == W.len) {
I << (j - k)
k = T[k]
}
}
elsif ((k = T[k]) < 0) {
++j
++k
}
}
return I
}
var texts = [
"GCTAGCTCTACGAGTCTA",
"GGCTATAATGCGTA",
"there would have been a time for such a word",
"needle need noodle needle",
"BharôtভাৰতBharôtভারতIndiaBhāratભારતBhāratभारतBhārataಭಾರತBhāratभारतBhārat"+
"amഭാരതംBhāratभारतBhāratभारतBharôtôଭାରତBhāratਭਾਰਤBhāratamभारतम्Bārataபாரத"+
"ம்BhāratamഭാരതംBhāratadēsamభారతదేశం",
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnu"+
"thusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblyl"+
"anguagestoillustratetheconceptsandalgorithmsastheyarepresented",
"Nearby farms grew a half acre of alfalfa on the dairy's behalf, with ba"+
"les of all that alfalfa exchanged for milk.",
]
var pats = ["TCTA", "TAATAAA", "word", "needle", "ഭാരതം", "put", "and", "alfalfa"]
texts.each_kv {|k,v| say "text#{k} = #{v}" }; say ''
pats.each_kv {|k,v|
var j = (k < 6 ? k : k-1)
say ("Found '#{v}' in 'text#{j}' at indices ", kmp_search(texts[j], v))
}</syntaxhighlight>
{{out}}
<pre>text0 = GCTAGCTCTACGAGTCTA
text1 = GGCTATAATGCGTA
text2 = there would have been a time for such a word
text3 = needle need noodle needle
text4 = BharôtভাৰতBharôtভারতIndiaBhāratભારતBhāratभारतBhārataಭಾರತBhāratभारतBhāratamഭാരതംBhāratभारतBhāratभारतBharôtôଭାରତBhāratਭਾਰਤBhāratamभारतम्Bārataபாரதம்BhāratamഭാരതംBhāratadēsamభారతదేశం
text5 = InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented
text6 = Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk.
Found 'TCTA' in 'text0' at indices [6, 14]
Found 'TAATAAA' in 'text1' at indices []
Found 'word' in 'text2' at indices [40]
Found 'needle' in 'text3' at indices [0, 19]
Found 'ഭാരതം' in 'text4' at indices [68, 138]
Found 'put' in 'text5' at indices [26, 90]
Found 'and' in 'text5' at indices [101, 128, 171]
Found 'alfalfa' in 'text6' at indices [33, 87]</pre>
=={{header|Wren}}==
This is based on the code [https://www.geeksforgeeks.org/kmp-algorithm-for-pattern-searching/ here]. The examples used are the same as in the [[Boyer-Moore_string_search#Wren]] task.
<syntaxhighlight lang="wren">class KMP {
static search(haystack, needle) {
haystack = haystack.bytes.toList
needle = needle.bytes.toList
var hc = haystack.count
var nc = needle.count
var indices = []
var i = 0 // index into haystack
var j = 0 // index into needle
var t = table_(needle)
while (i < hc) {
if (needle[j] == haystack[i]) {
i = i + 1
j = j + 1
}
if (j == nc) {
indices.add(i - j)
j = t[j-1]
} else if (i < hc && needle[j] != haystack[i]) {
if (j != 0) {
j = t[j-1]
} else {
i = i + 1
}
}
}
return indices
}
static table_(needle) {
var nc = needle.count
var t = List.filled(nc, 0)
var i = 1 // index into table
var len = 0 // length of previous longest prefix
while (i < nc) {
if (needle[i] == needle[len]) {
len = len + 1
t[i] = len
i = i + 1
} else if (len != 0) {
len = t[len-1]
} else {
t[i] = 0
i = i + 1
}
}
return t
}
}
var texts = [
"GCTAGCTCTACGAGTCTA",
"GGCTATAATGCGTA",
"there would have been a time for such a word",
"needle need noodle needle",
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented",
"Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk."
]
var pats = ["TCTA", "TAATAAA", "word", "needle", "put", "and", "alfalfa"]
for (i in 0...texts.count) System.print("text%(i+1) = %(texts[i])")
System.print()
for (i in 0...pats.count) {
var j = (i < 5) ? i : i-1
System.print("Found '%(pats[i])' in 'text%(j+1)' at indices %(KMP.search(texts[j], pats[i]))")
}</syntaxhighlight>
{{out}}
<pre>text1 = GCTAGCTCTACGAGTCTA
text2 = GGCTATAATGCGTA
text3 = there would have been a time for such a word
text4 = needle need noodle needle
text5 = InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented
text6 = Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk.
Found 'TCTA' in 'text1' at indices [6, 14]
Found 'TAATAAA' in 'text2' at indices []
Found 'word' in 'text3' at indices [40]
Found 'needle' in 'text4' at indices [0, 19]
Found 'put' in 'text5' at indices [26, 90]
Found 'and' in 'text5' at indices [101, 128, 171]
Found 'alfalfa' in 'text6' at indices [33, 87]</pre>
| |||