Information for "Bioinformatics/base count"

Basic information

Display titleBioinformatics/base count
Default sort keyBioinformatics/base count
Page length (in bytes)149,543
Namespace ID0
Page ID12646
Page content languageen - English
Page content modelwikitext
Indexing by robotsAllowed
Number of redirects to this page0
Counted as a content pageYes
Number of subpages of this page0 (0 redirects; 0 non-redirects)

Page protection

EditAllow all users (infinite)
MoveAllow all users (infinite)
View the protection log for this page.

Edit history

Page creatorrosettacode>Paddy3118
Date of page creation21:00, 25 November 2019
Latest editorHellomike (talk | contribs)
Date of latest edit10:58, 8 November 2023
Total number of edits129
Recent number of edits (within past 180 days)4
Recent number of distinct authors4

Page properties

Transcluded templates (12)

Templates used on this page:

SEO properties

Description

Content

Article description: (description)
This attribute controls the content of the description and og:description elements.
Given this string representing ordered DNA bases: CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT...
Information from Extension:WikiSEO