Information for "Bioinformatics/base count"

Basic information

Display title	Bioinformatics/base count
Default sort key	Bioinformatics/base count
Page length (in bytes)	161,735
Namespace ID	0
Page ID	12647
Page content language	en - English
Page content model	wikitext
Indexing by robots	Allowed
Number of redirects to this page	0
Counted as a content page	Yes
Number of subpages of this page	0 (0 redirects; 0 non-redirects)
Page views in the past month	0
Page image

Edit	Allow all users (infinite)
Move	Allow all users (infinite)

Page creator	rosettacode>Paddy3118
Date of page creation	21:00, 25 November 2019
Latest editor	Wutang (talk \| contribs)
Date of latest edit	00:30, 21 October 2024
Total number of edits	141
Recent number of edits (within past 180 days)	11
Recent number of distinct authors	6

Hidden category (1)	This page is a member of a hidden category: Category:Pages with syntax highlighting errors
Transcluded templates (12)	Templates used on this page: Template:FormulaeEntry (view source) Template:Header (view source) Template:Infobox begin (view source) Template:Infobox end (view source) Template:Libheader (view source) Template:Out (view source) Template:Output (view source) Template:Strings (view source) Template:Task (view source) Template:Task/Icon (view source) Template:Trans (view source) Template:Works with (view source)

Description	Content
Article description: (`description`) This attribute controls the content of the `description` and `og:description` elements.	Given this string representing ordered DNA bases: CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT...

Information from Extension:WikiSEO