Bioinformatics/Subsequence: Difference between revisions
m
→{{header|Raku}}: Allow for later versions to work
Thundergnat (talk | contribs) m (Automated syntax highlighting fixup (second round - minor fixes)) |
Thundergnat (talk | contribs) m (→{{header|Raku}}: Allow for later versions to work) |
||
Line 785:
=={{header|Raku}}==
Chances are actually pretty small that a random 4 codon string will show up at all in a random 200 codon sequence. Bump up the sequence size to get a reasonable chance of multiple matches.
<syntaxhighlight lang="raku" line>use String::Splice:ver<0.0.3+>;
my $line = 80;
Line 825:
AGTACTCGACTGTTATGGTAAAAGGGCATCGTGATCGTTTATATTAATCATTGGGACAGGTGGTTAATGTCA<span style="color: #CC0000;">TAGC</span>TTAG<br>
</div>
=={{header|REXX}}==
This REXX version allows the user to specify:
| |||