Bioinformatics/Subsequence: Difference between revisions

Line 5:

Write a routine to find all the positions of a randomly generated subsequence   (four letters).

=={{header|11l}}==

<syntaxhighlight lang=11l>UInt32 seed = 34

<syntaxhighlight lang="11l">UInt32 seed = 34

F nonrandom_choice(lst)

:seed = (1664525 * :seed + 1013904223) [&] FFFF'FFFF

Line 66:

Line 65:

94:98

</pre>

=={{header|Action!}}==

<syntaxhighlight lang=~~Action~~!>DEFINE SEQLEN="200"

<syntaxhighlight lang="action!">DEFINE SEQLEN="200"

DEFINE SUBLEN="4"

Line 159:

Line 157:

83-86

</pre>

=={{header|Ada}}==

<syntaxhighlight lang=~~Ada~~>with Ada.Text_Io;

<syntaxhighlight lang="ada">with Ada.Text_Io;

with Ada.Strings.Fixed;

with Ada.Numerics.Discrete_Random;

Line 243:

Line 240:

Found at position: 371..374

Found at position: 380..383</pre>

=={{header|Arturo}}==

<syntaxhighlight lang=rebol>bases: [`A` `G` `C` `T`]

<syntaxhighlight lang="rebol">bases: [`A` `G` `C` `T`]

randSeq: join map 1..200 => [sample bases]

randSub: join map 1..4 => [sample bases]

Line 285:

Line 281:

Found subsequence at position: 71

Found subsequence at position: 169</pre>

=={{header|Factor}}==

<syntaxhighlight lang=factor>USING: accessors formatting grouping io kernel math

<syntaxhighlight lang="factor">USING: accessors formatting grouping io kernel math

math.functions.integer-logs math.parser random regexp sequences ;

Line 352:

Line 347:

312..316

</pre>

=={{header|Go}}==

<syntaxhighlight lang=go>package main

<syntaxhighlight lang="go">package main

import (

Line 444:

Line 438:

388..391

</pre>

=={{header|jq}}==

Line 457:

Line 450:

`jot -r N MIN MAX` but a fourth argument can also be

used to specify a seed. An alternative would be to use `gshuf` along the lines of:

# For 200 pseudo-random integers in the range 0 to 3 inclusive:

gshuf -i 0-3 -r -n 200 --random-source=/dev/random

Line 463:

Line 456:

Note that the indices shown below are offsets (i.e., the index origin is taken to be 0).

#!/bin/bash

Line 494:

Line 487:

55 141 169

</pre>

=={{header|Julia}}==

<syntaxhighlight lang=julia>DNArand(n, bases=['A', 'T', 'C', 'G']) = String(rand(bases, n))

<syntaxhighlight lang="julia">DNArand(n, bases=['A', 'T', 'C', 'G']) = String(rand(bases, n))

DNAsearch(needle, haystack, lap=true) = findall(needle, haystack, overlap=lap)

Line 512:

Line 504:

21:24 74:77 99:102

</pre>

=={{header|Nim}}==

<syntaxhighlight lang=~~Nim~~>import random, sequtils, strutils

<syntaxhighlight lang="nim">import random, sequtils, strutils

proc dnaSequence(n: Positive): string =

Line 571:

Line 562:

Subsequence found at positions: 61, 122, 170</pre>

=={{header|Perl}}==

<syntaxhighlight lang=perl>use strict;

<syntaxhighlight lang="perl">use strict;

use warnings;

use feature 'say';

Line 596:

Line 586:

TGCGAG >CCTG< TAGAGCCGGGCCTCAAATTAAACGAAAAAT

ATAAGTTTGCTTGGCACGCTGTACTACTTATCC >CCTG< ACT</pre>

=={{header|Phix}}==

Currently only searches for non-overlapped sequences, but it should be pretty obvious how to change that, in which case the next underline will simply partially overwrite the previous, so you'll get eg "<=<==>".

with javascript_semantics

Line 675:

Line 664:

GCTA does not occur

</pre>

=={{header|Python}}==

Line 681:

Line 669:

from random import choice

import regex as re

Line 729:

Line 717:

167:171

</pre>

=={{header|Racket}}==

<syntaxhighlight lang=racket>#lang racket

<syntaxhighlight lang="racket">#lang racket

(define (rand-seq n)

Line 796:

Line 783:

350 : GGCCTCGACCCAATTTAACCTCCCACTCCGTGGGTACAGCTTGAACCCCC

((245 . 248) (250 . 253) (329 . 332) (386 . 389))</pre>

=={{header|Raku}}==

Chances are actually pretty small that a random 4 codon string will show up at all in a random 200 codon sequence. Bump up the sequence size to get a reasonable chance of multiple matches.

<syntaxhighlight lang=raku line>use String::Splice:ver<0.0.3>;

<syntaxhighlight lang="raku" line>use String::Splice:ver<0.0.3>;

my $line = 80;

Line 839:

Line 825:

AGTACTCGACTGTTATGGTAAAAGGGCATCGTGATCGTTTATATTAATCATTGGGACAGGTGGTTAATGTCATAGCTTAG

</div>

=={{header|REXX}}==

This REXX version allows the user to specify:

Line 849:

Line 834:

:*   DNA proteins to be searched in the data         (the default is four unique random proteins).

:*   the seed for the RANDOM function so runs can be repeated with the same data     (no default).

<syntaxhighlight lang=rexx>/*REXX pgm gens random DNA (ACGT) sequence & finds positions of a random 4─protein seq. */

<syntaxhighlight lang="rexx">/*REXX pgm gens random DNA (ACGT) sequence & finds positions of a random 4─protein seq. */

parse arg totLen rndLen basePr oWidth Bevery rndDNA seed .

if totLen=='' | totLen=="," then totLen= 200 /*Not specified? Then use the default.*/

Line 931:

Line 916:

the random DNA proteins were found in positions: 5 6 16 69 157 158 159 340 796 797 962 963

</pre>

=={{header|Ring}}==

/*-----------------------------------

# Project : DNA subsequences

Line 1,186:

Line 1,170:

[https://i.imgur.com/5hhbRBK.mp4 Bioinformatics/Subsequence - video]

=={{header|Wren}}==

<syntaxhighlight lang=ecmascript>import "random" for Random

<syntaxhighlight lang="ecmascript">import "random" for Random

import "/pattern" for Pattern

import "/str" for Str