Bioinformatics/base count

From Rosetta Code
Bioinformatics/base count
You are encouraged to solve this task according to the task description, using any language you may know.

Given this string representing ordered DNA bases:


  •   "Pretty print" the sequence followed by a summary of the counts of each of the bases:   (A, C, G, and T)   in the sequence
  •   print the total count of each base in the string.

Other tasks related to string operations:
Song lyrics/poems/Mad Libs/phrases


Translation of: Python
F basecount(dna)
   DefaultDict[Char, Int] d
   L(c) dna
   R sorted(d.items())

F seq_split(dna, n = 50)
   R (0 .< dna.len).step(n).map(i -> @dna[i .+ @n])

F seq_pp(dna, n = 50)
   L(part) seq_split(dna, n)
      print(‘#5: #.’.format(L.index * n, part))
   print("\n  BASECOUNT:")
   V tot = 0
   L(base, count) basecount(dna)
      print(‘    #3: #.’.format(base, count))
      tot += count
   V (base, count) = (‘TOT’, tot)
   print(‘    #3= #.’.format(base, count))

V sequence = "\

      A: 129
      C: 97
      G: 119
      T: 155
    TOT= 500


I the solution the number of nucleotides per row is equal 30 to fit the screen on Atari 8-bit computer.


PROC PrettyPrint(PTR ARRAY data INT count,gsize,gcount)
  INT index,item,i,ingroup,group,a,t,c,g
  CHAR ch

  index=0 item=0 i=1 ingroup=0 group=0
  a=0 t=0 g=0 c=0
    WHILE i>s(0)
      i=1 item==+1
      IF item>=count THEN EXIT FI
    IF item>=count THEN EXIT FI

    IF group=0 AND ingroup=0 THEN
      IF index<10 THEN Put(32) FI
      IF index<100 THEN Put(32) FI
      PrintI(index) Print(":")
    IF ingroup=0 THEN Put(32) FI
    ch=s(i) i==+1
    IF ch='A THEN a==+1
    ELSEIF ch='T THEN t==+1
    ELSEIF ch='C THEN c==+1
    ELSEIF ch='G THEN g==+1 FI
    IF ingroup>=gsize THEN
      ingroup=0 group==+1
      IF group>=gcount THEN
  PrintF("%E%EBases: A:%I, T:%I, C:%I, G:%I%E",a,t,c,g)
  PrintF("%ETotal: %I",a+t+g+c)

PROC Main()
  PTR ARRAY data(10)

  LMARGIN=0 ;remove left margin on the screen
  Put(125) PutE() ;clear the screen



  LMARGIN=oldLMARGIN ;restore left margin on the screen

Screenshot from Atari 8-bit computer


Bases: A:129, T:155, C:97, G:119

Total: 500


with Ada.Text_Io;

procedure Base_Count is

   type Sequence is new String;
   Test : constant Sequence :=

   Line_Width : constant := 70;

   procedure Put (Seq : Sequence) is
      use Ada.Text_Io;
      package Position_Io is new Ada.Text_Io.Integer_Io (Natural);
      First : Natural := Seq'First;
      Last  : Natural;
         Last := Natural'Min (Seq'Last, First + Line_Width - 1);
         Position_Io.Put (First, Width => 3);
         Put (String'(".."));
         Position_Io.Put (Last, Width => 3);
         Put (String'("  "));
         Put (String (Seq (First .. Last)));
         exit when Last = Seq'Last;
         First := First + Line_Width;
      end loop;
   end Put;

   procedure Count (Seq : Sequence) is
      use Ada.Text_Io;
      A_Count, C_Count : Natural := 0;
      G_Count, T_Count : Natural := 0;
      for B of Seq loop
         case B is
            when 'A' =>  A_Count := A_Count + 1;
            when 'C' =>  C_Count := C_Count + 1;
            when 'G' =>  G_Count := G_Count + 1;
            when 'T' =>  T_Count := T_Count + 1;
            when others =>
               raise Constraint_Error;
         end case;
      end loop;
      Put_Line ("A: " & A_Count'Image);
      Put_Line ("C: " & C_Count'Image);
      Put_Line ("G: " & G_Count'Image);
      Put_Line ("T: " & T_Count'Image);
      Put_Line ("Total: " & Seq'Length'Image);
   end Count;

   Put (Test);
   Count (Test);
end Base_Count;
491..500  CGAACGTAAT
A:  129
C:  97
G:  119
T:  155
Total:  500


Includes a count for non-bases if they are present in the sequence, as this would presumably indicate an error.

BEGIN # count DNA bases in a sequence                                        #
    # returns an array of counts of the characters in s that are in c        #
    #         an extra final element holds the count of characters not in c  #
    PRIO COUNT = 9;
    OP   COUNT = ( STRING s, STRING c )[]INT:
            [ LWB c : UPB c + 1 ]INT results; # extra element for "other"    #
            [ 0     : 255       ]INT counts;  # only counts ASCII characters #
            FOR i FROM LWB counts  TO UPB counts  DO counts[  i ] := 0 OD;
            FOR i FROM LWB results TO UPB results DO results[ i ] := 0 OD;
            # count the occurrences of each ASCII character in s              #
            FOR i FROM LWB s TO UPB s DO
                IF INT ch pos = ABS s[ i ];
                   ch pos >= LWB counts AND ch pos <= UPB counts
                    # have a character we can count                          #
                    counts[ ch pos ] +:= 1
                    # not an ASCII character ?                               #
                    results[ UPB results ] +:= 1
            # return the counts of the required characters                   #
            # set the results for the expected characters and clear their    #
            # counts so we can count the "other" characters                  #
            FOR i FROM LWB results TO UPB results - 1 DO
                IF INT ch pos = ABS c[ i ];
                   ch pos >= LWB counts AND ch pos <= UPB counts
                    results[ i ]     := counts[ ch pos ];
                    counts[ ch pos ] := 0
            # count the "other" characters                                   #
            FOR i FROM LWB counts TO UPB counts DO
                IF counts[ i ] /= 0 THEN
                    results[ UPB results ] +:= counts[ i ]
         END; # COUNT #
    # returns the combined counts of the characters in the elements of s     #
    #         that are in c                                                  #
    #         an extra final element holds the count of characters not in c  #
    OP   COUNT = ( []STRING s, STRING c )[]INT:
            [ LWB c : UPB c + 1 ]INT results;
            FOR i FROM LWB results TO UPB results DO results[ i ] := 0 OD;
            FOR i FROM LWB s TO UPB s DO
                []INT counts = s[ i ] COUNT c;
                FOR i FROM LWB results TO UPB results DO
                   results[ i ] +:= counts[ i ]
         END; # COUNT #
    # returns the length of s                                                #
    OP   LEN = ( STRING s )INT: ( UPB s - LWB s ) + 1;
    # count the bases in the required sequence                               #
    STRING bases  = "ATCG";
    []INT  counts = seq COUNT bases;
    # print the sequence with leading character positions                    #
    # find the overall length of the sequence                                #
    INT   seq len := 0;
    FOR i FROM LWB seq TO UPB seq DO
        seq len +:= LEN seq[ i ]
    # compute the minimum field width required for the positions             #
    INT   s len   := seq len;
    INT   width   := 1;
    WHILE  s len >= 10 DO
        width +:= 1;
        s len OVERAB 10
    # show the sequence                                                      #
    print( ( "Sequence:", newline, newline ) );
    INT start := 0;
    FOR i FROM LWB seq TO UPB seq DO
        print( ( " ", whole( start, - width ), " :", seq[ i ], newline ) );
        start +:= LEN seq[ i ]
    # show the base counts                                                   #
    print( ( newline, "Bases: ", newline, newline ) );
    INT total := 0;
    FOR i FROM LWB bases TO UPB bases DO
        print( ( "  ", bases[ i ], "  : ", whole( counts[ i ], - width ), newline ) );
        total +:= counts[ i ]
    # show the count of other characters (invalid bases) - if there are any  #
    IF INT others = UPB counts;
       counts[ others ] /= 0
        # there were characters other than the bases                         #
        print( ( newline, "Other: ", whole( counts[ others ], - width ), newline, newline ) );
        total +:= counts[ UPB counts ]
    # totals                                                                 #
    print( ( newline, "Total: ", whole( total, - width ), newline ) )



  A  : 129
  T  : 155
  C  :  97
  G  : 119

Total: 500


Works with: Dyalog APL
      50 {ws{(w×1-),((w÷s) w s)[;]} (s)÷} bases
  A: 129  C: 97  G: 119  T: 155

Total: 500


dna: {

prettyPrint: function [in][
    count: #[ A: 0, T: 0, G: 0, C: 0 ]

    loop.with:'i split.lines in 'line [
        prints [pad to :string i*50 3 ":"]
        print split.every:10 line

        loop split line 'ch [
            case [ch=]
                when? -> "A" -> count\A: count\A + 1
                when? -> "T" -> count\T: count\T + 1
                when? -> "G" -> count\G: count\G + 1
                when? -> "C" -> count\C: count\C + 1
                else []
    print ["Total count => A:" count\A, "T:" count\T "G:" count\G "C:" count\C]

prettyPrint dna
Total count => A: 129 T: 155 G: 119 C: 97


# converted from FreeBASIC
# sorting:
#   PROCINFO["sorted_in"] is used by GAWK
#   SORTTYPE is used by Thompson Automation's TAWK
    curr = first = 1
    while (curr <= length(dna)) {
      curr_base = substr(dna,curr,1)
      rec = sprintf("%s%s",rec,curr_base)
      if (curr % 10 == 1) {
        rec = sprintf("%s ",rec)
      if (curr % 50 == 1) {
        printf("%3d-%3d: %s\n",first,curr-1,rec)
        rec = ""
        first = curr
    PROCINFO["sorted_in"] = "@ind_str_asc" ; SORTTYPE = 1
    printf("\nBase count\n")
    for (i in base_arr) {
      printf("%s %8d\n",i,base_arr[i])
      total += base_arr[i]
    printf("%10d total\n",total)

Base count
A      129
C       97
G      119
T      155
       500 total


Reads genome from a file, determines string length to ensure optimal formatting


typedef struct genome{
    char* strand;
    int length;
    struct genome* next;

genome* genomeData;
int totalLength = 0, Adenine = 0, Cytosine = 0, Guanine = 0, Thymine = 0;

int numDigits(int num){
    int len = 1;

        num = num/10;

    return len;

void buildGenome(char str[100]){
    int len = strlen(str),i;
    genome *genomeIterator, *newGenome; 

    totalLength += len;

            case 'A': Adenine++;
            case 'T': Thymine++;
            case 'C': Cytosine++;
            case 'G': Guanine++;

        genomeData = (genome*)malloc(sizeof(genome));

        genomeData->strand = (char*)malloc(len*sizeof(char));
        genomeData->length = len;

        genomeData->next = NULL;

        genomeIterator = genomeData;

            genomeIterator = genomeIterator->next;

        newGenome = (genome*)malloc(sizeof(genome));

        newGenome->strand = (char*)malloc(len*sizeof(char));
        newGenome->length = len;

        newGenome->next = NULL;
        genomeIterator->next = newGenome;

void printGenome(){
    genome* genomeIterator = genomeData;

    int width = numDigits(totalLength), len = 0;


        len += genomeIterator->length;

        genomeIterator = genomeIterator->next;

    printf("\n\nBase Count\n----------\n\n");

    printf("\n%3s%*d\n","Total:",width+1,Adenine + Thymine + Cytosine + Guanine);


int main(int argc,char** argv)
    char str[100];
    int counter = 0, len;
        printf("Usage : %s <Gene file name>\n",argv[0]);
        return 0;

    FILE *fp = fopen(argv[1],"r");



    return 0;

Run and output :

abhishek_ghosh@Azure:~/doodles$ ./a.out genome.txt


Base Count

  A  : 129
  T  : 155
  C  :  97
  G  : 119

Total: 500


Creates a class DnaBase which either uses a provided string or the default DNA sequence.

#include <map>
#include <string>
#include <iostream>
#include <iomanip>


class DnaBase {
    DnaBase(const std::string& dna = DEFAULT_DNA, int width = 50) : genome(dna), displayWidth(width) {
        // Map each character to a counter
        for (auto elm : dna) {
            if (count.find(elm) == count.end())
                count[elm] = 0;

    void viewGenome() {
        std::cout << "Sequence:" << std::endl;
        std::cout << std::endl;
        int limit = genome.size() / displayWidth;
        if (genome.size() % displayWidth != 0)

        for (int i = 0; i < limit; ++i) {
            int beginPos = i * displayWidth;
            std::cout << std::setw(4) << beginPos << "  :" << std::setw(4) << genome.substr(beginPos, displayWidth) << std::endl;
        std::cout << std::endl;
        std::cout << "Base Count" << std::endl;
        std::cout << "----------" << std::endl;
        std::cout << std::endl;
        int total = 0;
        for (auto elm : count) {
            std::cout << std::setw(4) << elm.first << " : " << elm.second << std::endl;
            total += elm.second;
        std::cout << std::endl;
        std::cout << "Total: " << total << std::endl;

    std::string genome;
    std::map<char, int> count;
    int displayWidth;

int main(void) {
    auto d = new DnaBase();
    delete d;
    return 0;


Base Count

   A : 129
   C : 97
   G : 119
   T : 155

Total: 500


program base_count;




procedure Println(code: ansistring);
  c: ansichar;
  console.ForegroundColor := TConsoleColor.Black;
  for c in code do
    case c of
        console.BackgroundColor := TConsoleColor.Red;
        console.BackgroundColor := TConsoleColor.Blue;
        console.BackgroundColor := TConsoleColor.Green;
        console.BackgroundColor := TConsoleColor.Yellow;
      console.BackgroundColor := TConsoleColor.Black;
  console.ForegroundColor := TConsoleColor.White;
  console.BackgroundColor := TConsoleColor.Black;

  var le := Length(DNA);
  var index := 0;
  while index < le do
    Write(index: 5, ': ');
    Println(dna.Substring(index, 50));

    inc(index, 50);

  var baseMap := TDictionary<byte, integer>.Create;

  for var i := 1 to le do
    var key := ord(dna[i]);
    if baseMap.ContainsKey(key) then
      baseMap[key] := baseMap[key] + 1
      baseMap.Add(key, 1);

  var bases: TArray<byte>;
  for var k in baseMap.Keys do
    SetLength(bases, Length(bases) + 1);
    bases[High(bases)] := k;

  console.WriteLine(#10'BASE COUNT:');

  for var base in bases do
    console.WriteLine('    {0}: {1}', [ansichar(base), baseMap[base]]);

  console.WriteLine('    ------');
  console.WriteLine('    S: {0}', [le]);
  console.WriteLine('    ======');


Color [1]


    A: 129
    C: 97
    G: 119
    T: 155
    Σ: 500


USING: assocs formatting grouping io kernel literals math
math.statistics prettyprint qw sequences sorting ;

    } concat

: .dna ( seq n -- )
    "SEQUENCE:" print [ group ] keep
    [ * swap "  %3d: %s\n" printf ] curry each-index ;

: show-counts ( seq -- )
    "BASE COUNTS:" print histogram >alist [ first ] sort-with
    [ [ "    %c: %3d\n" printf ] assoc-each ]
    [ "TOTAL: " write [ second ] [ + ] map-reduce . ] bi ;

dna [ 50 .dna nl ] [ show-counts ] bi

    A: 129
    C:  97
    G: 119
    T: 155
TOTAL: 500


( Gforth 0.7.3 )


variable #A \ Gforth initialises variables to 0
variable #C
variable #G
variable #T
variable #ch
50 constant pplength

: basecount ( adr u -- )
    ." Sequence:"
    swap dup rot + swap ?do  \ count while pretty-printing
        #ch @ pplength mod 0= if cr #ch @ 10 .r 2 spaces then
        i c@ dup emit
        dup 'A = if drop #A @ 1+ #A ! else
        dup 'C = if drop #C @ 1+ #C ! else
        dup 'G = if drop #G @ 1+ #G ! else
        dup 'T = if drop #T @ 1+ #T ! else drop then then then then
        #ch @ 1+ #ch !
    cr cr ." Base counts:"
    cr 4 spaces 'A emit ': emit #A @ 5 .r
    cr 4 spaces 'C emit ': emit #C @ 5 .r
    cr 4 spaces 'G emit ': emit #G @ 5 .r
    cr 4 spaces 'T emit ': emit #T @ 5 .r
    cr ."  ----------"
    cr ."   Sum:"  #ch @ 5 .r
    cr ."  ==========" cr cr

( demo run: )

dnacode basecount

Base counts:
    A:  129
    C:   97
    G:  119
    T:  155
  Sum:  500


#define SCW 36
#define GRP 3

function padto( n as integer, w as integer ) as string
    dim as string r = str(n)
    while len(r)<w
       r = " "+r
    return r
end function


dim as string outstr = "", currb
dim as integer bases(0 to 3), curr = 1, first = 1
while curr <= len(dna)
    currb = mid(dna, curr, 1)
    if currb = "A" then bases(0) += 1
    if currb = "C" then bases(1) += 1
    if currb = "G" then bases(2) += 1
    if currb = "T" then bases(3) += 1
    outstr += currb
    curr += 1
    if curr mod GRP = 1 then outstr += " "
    if curr mod SCW = 1 or curr=len(dna)+1 then
        outstr = padto(first,3) + "--" + padto(curr-1,3) + ":   " + outstr
        print outstr
        outstr = ""
        first = curr
    end if
print "Base counts"
print "-----------"
print "     A:  " + str(bases(0))
print "     C:  " + str(bases(1))
print "     G:  " + str(bases(2))
print "     T:  " + str(bases(3))
print " total:  " + str(bases(0)+bases(1)+bases(2)+bases(3))

Base counts
     A:  129
     C:  97
     G:  119
     T:  155

 total:  500


window 1, @"Bioinformatics/base count"

local fn SubstringCount( string as CFStringRef, substring as CFStringRef ) as long
  CFStringRef tempString = fn StringByReplacingOccurrencesOfString( string, substring, @"" )
end fn = len(string) - len(tempString)

void local fn DoIt
  CFArrayRef  sequence
  CFStringRef string
  long        index = 0
  long        a = 0, c = 0, g = 0, t = 0
  for string in sequence
    printf @"%3ld: %@",index,string
    index += len(string)
    a += fn SubstringCount( string, @"A" )
    c += fn SubstringCount( string, @"C" )
    g += fn SubstringCount( string, @"G" )
    t += fn SubstringCount( string, @"T" )
  printf @"A:\t\t%3ld",a
  printf @"C:\t\t%3ld",c
  printf @"G:\t\t%3ld",g
  printf @"T:\t\t%3ld",t
  printf @"\t\t---"
  printf @"Total:\t%ld",a+c+g+t  
end fn

fn DoIt


A:     129
C:      97
G:     119
T:     155
Total: 500


Fōrmulæ programs are not textual, visualization/edition of programs is done showing/manipulating structures but not text. Moreover, there can be multiple visual representations of the same program. Even though it is possible to have textual representation —i.e. XML, JSON— they are intended for storage and transfer purposes more than visualization and edition.

Programs in Fōrmulæ are created/edited online in its website, However they run on execution servers. By default remote servers are used, but they are limited in memory and processing power, since they are intended for demonstration and casual use. A local server can be downloaded and installed, it has no limitations (it runs in your own computer). Because of that, example programs can be fully visualized and edited, but some of them will not run if they require a moderate or heavy computation/memory resources, and no local server is being used.

In this page you can see the program(s) related to this task and their results.


package main

import (

func main() {
    dna := "" +

    le := len(dna)
    for i := 0; i < le; i += 50 {
        k := i + 50
        if k > le {
            k = le
        fmt.Printf("%5d: %s\n", i, dna[i:k])
    baseMap := make(map[byte]int) // allows for 'any' base
    for i := 0; i < le; i++ {
    var bases []byte
    for k := range baseMap {
        bases = append(bases, k)
    sort.Slice(bases, func(i, j int) bool { // get bases into alphabetic order
        return bases[i] < bases[j]

    fmt.Println("\nBASE COUNT:")
    for _, base := range bases {
        fmt.Printf("    %c: %3d\n", base, baseMap[base])
    fmt.Println("    ------")
    fmt.Println("    Σ:", le)
    fmt.Println("    ======")

    A: 129
    C:  97
    G: 119
    T: 155
    Σ: 500


import Data.List       (group, sort)
import Data.List.Split (chunksOf)
import Text.Printf     (printf, IsChar(..), PrintfArg(..), fmtChar, fmtPrecision, formatString)

data DNABase = A | C | G | T deriving (Show, Read, Eq, Ord)
type DNASequence = [DNABase]

instance IsChar DNABase where
  toChar = head . show
  fromChar = read . pure

instance PrintfArg DNABase where
  formatArg x fmt = formatString (show x) (fmt { fmtChar = 's', fmtPrecision = Nothing })

test :: DNASequence
test = read . pure <$> concat

chunkedDNASequence :: DNASequence -> [(Int, [DNABase])]
chunkedDNASequence = zip [50,100..] . chunksOf 50

baseCounts :: DNASequence -> [(DNABase, Int)]
baseCounts = fmap ((,) . head <*> length) . group . sort

main :: IO ()
main = do
  putStrLn "Sequence:"
  mapM_ (uncurry (printf "%3d: %s\n")) $ chunkedDNASequence test
  putStrLn "\nBase Counts:"
  mapM_ (uncurry (printf "%2s: %2d\n")) $ baseCounts test
  putStrLn (replicate 8 '-') >> printf " Σ: %d\n\n" (length test)

Base Counts:
 A: 129
 C: 97
 G: 119
 T: 155
 Σ: 500



countBases=: (({.;#)/.~)@,
totalBases=: #@,

require 'format/printf'

printSequence=: verb define
'Sequence:' printf ''
'%4d: %s' printf ((- {.)@(+/\)@:(#"1) ,.&<"_1 ]) y
'\n Base Count\n-----------' printf ''
'%5s: %4d' printf countBases y
'-----------\nTotal = %3d' printf totalBases y

Required Example:

   DNABases=: ];._2 noun define
   printSequence DNABases

 Base Count
    C:   97
    G:  119
    T:  155
    A:  129
Total = 500


For counting the bases, we simply use a HashMap, and then use the Map.merge, inserting 1, and using Integer::sum as the aggregation function. This effectively creates a Map that keeps a running count for us. Java does provide the groupingBy and counting collectors, which would generally make these kinds of operation easier. However, String’s chars() method returns a IntStream, which generally just makes everything more complicated. Or verbose. Or inefficient. Ultimately, doing it by hand is easier and more efficient than with streams. The best tool for this job though would be Guava’s MultiSet, which is a dedicated Key to Count container.

Note that Java’s native strings are UCS-2/UTF-16: Each character is 2-byte long. If parsing from a very large ASCII/UTF8 text file, then String is a poor choice, as opposed to, say byte[]. For the purpose of this exercise though, using byte[] would just add uninteresting casts and bloat to the code, so we stick to String.

import java.util.HashMap;
import java.util.Map;

public class orderedSequence {
    public static void main(String[] args) {

/** Separate class for defining behaviors */
public class Sequence {
    private final String seq;
    public Sequence(String sq) {
        this.seq = sq;
    /** print the organized structure of the sequence */
    public void prettyPrint() {
        int i = 0;
        for ( ; i < seq.length() - 50 ; i += 50) {
            System.out.printf("%5s : %s\n", i + 50, seq.substring(i, i + 50));
        System.out.printf("%5s : %s\n", seq.length(), seq.substring(i));
    /** display a base vs. frequency chart */
    public void displayCount() {
        Map<Character, Integer> counter = new HashMap<>();
        for (int i = 0 ; i < seq.length() ; ++i) {
            counter.merge(seq.charAt(i), 1, Integer::sum);

        System.out.println("Base vs. Count:");
            key, value -> System.out.printf("%5s : %s\n", key, value));
        System.out.printf("%5s: %s\n", "SUM", seq.length());
    public void runSequence() {
Base vs. Count:
    A : 129
    C : 97
    T : 155
    G : 119
  SUM: 500


const rowLength = 50;

const bases = ['A', 'C', 'G', 'T'];

// Create the starting sequence
    .filter(e => bases.includes(e))

 * Convert the given array into an array of smaller arrays each with the length
 * given by n.
 * @param {number} n
 * @returns {function(!Array<*>): !Array<!Array<*>>}
const chunk = n => a => a.reduce(
    (p, c, i) => (!(i % n)) ? p.push([c]) && p : p[p.length - 1].push(c) && p,
const toRows = chunk(rowLength);

 * Given a number, return function that takes a string and left pads it to n
 * @param {number} n
 * @returns {function(string): string}
const padTo = n => v => ('' + v).padStart(n, ' ');
const pad = padTo(5);

 * Count the number of elements that match the given value in an array
 * @param {Array<string>} arr
 * @returns {function(string): number}
const countIn = arr => s => arr.filter(e => e === s).length;

 * Utility logging function
 * @param {string|number} v
 * @param {string|number} n
const print = (v, n) => console.log(`${pad(v)}:\t${n}`)

const prettyPrint = seq => {
  const chunks = toRows(seq);
  chunks.forEach((e, i) => print(i * rowLength, e.join('')))

const printBases = (seq, bases) => {
  const filterSeq = countIn(seq);
  const counts =;
  console.log('\nBASE COUNTS:')
  counts.forEach((e, i) => print(bases[i], e));
  print('Total', counts.reduce((p,c) => p + c, 0));

printBases(seq, bases);

    A:	129
    C:	97
    G:	119
    T:	155
Total:	500


Naive (in-memory) solution

First, some general utility functions:

def lpad($len; $fill): tostring | ($len - length) as $l | ($fill * $l)[:$l] + .;

# Create a bag of words, i.e. a JSON object with counts of the items in the stream
def bow(stream): 
  reduce stream as $word ({}; .[($word|tostring)] += 1);
Next, some helper functions:
def read_seq:
  reduce inputs as $line (""; . + $line);

# Emit a bow of the letters in the input string
def counts:
  . as $in | bow(range(0;length) | $in[.:.+1]);

def pp_counts:
   (counts | to_entries | sort[] | "    \(.key):  \(.value | lpad(6;" "))"),
   "Total: \(length|lpad(7;" "))" ;

def pp_sequence($cols):
  range(0; length / $cols) as $i
    | "\($i*$cols | lpad(5; " ")): " +  .[ $i * $cols : ($i+1) * $cols] ;
Finally, the task at hand:
read_seq | pp_sequence(50), "", pp_counts

The invocation:

   jq -nrR -f base_count.jq base_count.txt

    A:     129
    C:      97
    G:     119
    T:     155
Total:     500

Memory-efficient solution

def lpad($len; $fill): tostring | ($len - length) as $l | ($fill * $l)[:$l] + .;

# "bow" = bag of words, i.e. a JSON object with counts
# Input: a bow or null
# Output: augmented bow
def bow(stream): 
  reduce stream as $word (.; .[($word|tostring)] += 1);

# The main function ignores its input in favor of `stream`:
def report(stream; $cols):

  # input: a string, possibly longer than $cols
  def pp_sequence($start):
  range(0; length / $cols) as $i
    | "\($start + ($i*$cols) | lpad(5; " ")): " +  .[ $i * $cols : ($i+1) * $cols] ;

  # input: a bow
  def pp_counts:
     (to_entries | sort[] | "    \(.key):  \(.value | lpad(6;" "))"),
     "Total: \( [.[]] | add | lpad(7;" "))" ;

  # state: {bow, emit, pending, start}
  foreach (stream,null) as $line ({start: - $cols};
    .start += $cols
    | if $line == null
      then .emit = .pending
      else .bow |= bow(range(0; $line|length) | $line[.:.+1])
      | (($line|length) + (.pending|length) ) as $len
      | if $len >= $cols
        then (.pending + $line) as $new
        | .emit = $new[:$cols]
        | .pending = $new[$cols:]
        else .pending = $line
    (select(.emit|length > 0) | .start as $start | .emit | pp_sequence($start)),
    (select($line == null) | "", (.bow|pp_counts) ) )

# To illustrate reformatting:
report(inputs; 33)
  495: GTAAT

    A:     129
    C:      97
    G:     119
    T:     155
Total:     500


const sequence = 

function dnasequenceprettyprint(seq, colsize=50)
    println(length(seq), "nt DNA sequence:\n")
    rows = [seq[i:min(length(seq), i + colsize - 1)] for i in 1:colsize:length(seq)]
    for (i, r) in enumerate(rows)
        println(lpad(colsize * (i - 1), 5), "   ", r)


function printcounts(seq)
    bases = [['A', 0], ['C', 0], ['G', 0], ['T', 0]]
    for c in seq, base in bases
        if c == base[1]
            base[2] += 1
    println("\nNucleotide counts:\n")
    for base in bases
        println(lpad(base[1], 10), lpad(string(base[2]), 12))
    println(lpad("Other", 10), lpad(string(length(seq) - sum(x[2] for x in bases)), 12))
    println("     _________________\n", lpad("Total", 10), lpad(string(length(seq)), 12))


500nt DNA sequence:


Nucleotide counts:

         A         129
         C          97
         G         119
         T         155
     Other           0
     Total         500


For the first part, we can leverage the built-in String.chunked to transform a String into a List<String>, where each String has a defined chunk size. Iterable.withIndex allows you to loop over an iterable, while keeping track of the iteration index.

For counting the bases, we use groupingBy, which is a versatile tool for aggregating objects based on a key-function. In this case, the key function is the identity function (it), and the aggregation function is the counting function: eachCount.

Finally, the total count is simply the input’s length.

fun printSequence(sequence: String, width: Int = 50) {
    fun <K, V> printWithLabel(k: K, v: V) {
        val label = k.toString().padStart(5)
        println("$label: $v")

    sequence.chunked(width).withIndex().forEach { (i, line) ->
        printWithLabel(i*width + line.length, line)
    sequence.groupingBy { it }.eachCount().forEach { (k, v) ->
        printWithLabel(k, v)
    printWithLabel("TOTALS", sequence.length)


fun main() {
    C: 97
    G: 119
    T: 155
    A: 129


-> DNA

{def base_count
 {def base_count.r
  {lambda {:dna :b :n :i :count}
   {if {> :i :n}
    then :count
    else {base_count.r :dna :b :n {+ :i 1}
                       {if {W.equal? {W.get :i :dna} :b}
                        then {+ :count 1}
                        else :count}} }}}
 {lambda {:dna :b}
  {base_count.r :dna :b {- {W.length :dna} 1} 0 0} }}
-> base_count

{def S { {base_count {DNA}}} A C G T}} 
-> S 
[A C G T] = (129 97 119 155)

A+C+G+T = {+ {S}} 
-> A+C+G+T = 500


function prettyprint(seq) -- approx DDBJ format
  seq = seq:gsub("%A",""):lower()
  local sums, n = { a=0, c=0, g=0, t=0 }, 1
  seq:gsub("(%a)", function(c) sums[c]=sums[c]+1 end)
  local function printf(s,...) io.write(s:format(...)) end
  printf("LOCUS       AB000000     %12d bp    mRNA    linear   HUM 01-JAN-2001\n", #seq)
  printf(" BASE COUNT %12d a %12d c %12d g %12d t\n", sums.a, sums.c, sums.g, sums.t)
  while n < #seq do
    local sub60 = seq:sub(n,n+59)
    printf("%9d %s\n", n, sub60:gsub("(..........)","%1 "))
    n = n + #sub60

LOCUS       AB000000              500 bp    mRNA    linear   HUM 01-JAN-2001
 BASE COUNT          129 a           97 c          119 g          155 t
        1 cgtaaaaaat tacaacgtcc tttggctatc tcttaaactc ctgctaaatg ctcgtgcttt
       61 ccaattatgt aagcgttccg agacggggtg gtcgattctg aggacaaagg tcaagatgga
      121 gcgcatcgaa cgcaataagg atcatttgat gggacgtttc gtcgacaaag tcttgtttcg
      181 agagtaacgg ctaccgtctt cgattctgct tataacacta tgttcttatg aaatggatgt
      241 tctgagttgg tcagtcccaa tgtgcggggt ttcttttagt acgtcgggag tggtattata
      301 tttaattttt ctatatagcg atctgtattt aagcaattca tttaggttat cgccgcgatg
      361 ctcggttcgg accgccaagc atctggctcc actgctagtg tcctaaattt gaatggcaaa
      421 cacaaataag atttagcaat tcgtgtagac gaccggggac ttgcatgatg ggagcagctt
      481 tgttaaacta cgaacgtaat

Mathematica / Wolfram Language

size = 70;
parts = StringPartition[seq, UpTo[size]];
begins = Most[Accumulate[Prepend[StringLength /@ parts, 1]]];
ends = Rest[Accumulate[Prepend[StringLength /@ parts, 0]]];
StringRiffle[MapThread[ToString[#1] <> "-" <> ToString[#2] <> ": " <> #3 &, {begins, ends, parts}], "\n"]
StringRiffle[#1 <> ": " <> ToString[#2] & @@@ Tally[Characters[seq]], "\n"]
C: 97
G: 119
T: 155
A: 129

MATLAB / Octave

function r = base_count(f)
    fid = fopen(f,'r');
    while ~feof(fid)
	s = fgetl(fid);
	fprintf(1,'%5d :%s\n', sum(nn), s(s=='A'|s=='C'|s=='G'|s=='T'));
	nn = nn+[sum(s=='A'),sum(s=='C'),sum(s=='G'),sum(s=='T')];

    fprintf(1, '\nBases:\n\n  A  : %d\n  C  : %d\n  G  : %d\n  T  : %d\n', nn);
    fprintf(1, '\nTotal: %d\n\n', sum(nn));




  A  : 129
  C  : 97
  G  : 119
  T  : 155

Total: 500


Rather than inventing a new presentation format, we have chosen to use the EMBL (European Molecular Biology Laboratory) format which is well documented. See specifications here:

import strformat
import strutils


# Enumeration type for bases.
type Base* {.pure.} = enum A, C, G, T, Other = "other"

proc display*(dnaSeq: string) =
  ## Display a DNA sequence using EMBL format.

  var counts: array[Base, Natural]    # Count of bases.
  for c in dnaSeq:
    inc counts[parseEnum[Base]($c, Other)]  # Use Other as default value.

  # Display the SQ line.
  var sqline = fmt"SQ   {dnaSeq.len} BP; "
  for (base, count) in counts.pairs:
    sqline &= fmt"{count} {base}; "
  echo sqline

  # Display the sequence.
  var idx = 0
  var row = newStringOfCap(80)
  var remaining = dnaSeq.len

  while remaining > 0:
    row.add("     ")

    # Add groups of 10 bases.
    for group in 1..6:
      let nextIdx = idx + min(10, remaining)
      row.add(dnaSeq[idx..<nextIdx] & ' ')
      dec remaining, nextIdx - idx
      idx = nextIdx
      if remaining == 0:

    # Append the number of the last base in the row.
    row.add(spaces(72 - row.len))
    echo row

  # Add termination.
  echo "//"

when isMainModule:
SQ   500 BP; 129 A; 97 C; 119 G; 155 T; 0 other; 


program DNA_Base_Count;
  {$MODE DELPHI}//String = AnsiString
    dna =
  CntIdx : array of NativeUint;
  DNABases : String;
  SumBaseTotal : NativeInt;

procedure OutFormatBase(var DNA: String;colWidth:NativeInt);
  j: NativeInt;
  j := 0;
  Writeln(' DNA base sequence');
  While j<Length(DNA) do

procedure Cnt(const DNA: String);
  i,p :NativeInt;
  i := 1;
  while i <= Length(DNA) do
    p := Pos(DNA[i],DNABases);
    //found new base so extend list
    if p = 0 then
      DNABases := DNABases+DNA[i];
      p := length(DNABases);

  Writeln('Base     Count');
  SumBaseTotal := 0;
  For i := 1 to Length(DNABases) do
    p := CntIdx[i];
  Writeln('Total base count ',SumBaseTotal);

  TestDNA: String;
  DNABases :='ACGT';// predefined
  TestDNA := DNA;
 DNA base sequence

Base     Count
   A       129
   C        97
   G       119
   T       155
Total base count 500


use strict;
use warnings;
use feature 'say';

my %cnt;
my $total = 0;

while ($_ = <DATA>) {
    printf "%4d: %s\n", $total+1, s/(.{10})/$1 /gr;
    $total += length;
    $cnt{$_}++ for split //

say "\nTotal bases: $total";
say "$_: " . ($cnt{$_}//0) for <A C G T>;


Total bases: 500
A: 129
C: 97
G: 119
T: 155


constant dna = substitute("""
sequence acgt = repeat(0,5)
for i=1 to length(dna) do
    acgt[find(dna[i],"ACGT")] += 1
end for
acgt[$] = sum(acgt)
sequence s = split(trim(join_by(split(join_by(dna,1,10,""),"\n"),1,5," ")),"\n")
for i=1 to length(s) do
    printf(1,"%3d: %s\n",{(i-1)*50+1,s[i]})
end for
printf(1,"\nBase counts: A:%d, C:%d, G:%d, T:%d, total:%d\n",acgt)

Base counts: A:129, C:97, G:119, T:155, total:500


main =>
  dna(DNA, ChunkSize),
  Count = 0,
  Map = new_map(['A'=0,'C'=0,'G'=0,'T'=0]),
  foreach(Chunk in DNA.chunks_of(ChunkSize))
    printf("%4d: %s\n", Count, Chunk),
    Count := Count + Chunk.len,
    foreach(C in Chunk)
  println("\nBase count:"),
  foreach(C in "ACGT")
    printf("%5c: %3d\n", C, Map.get(C))
  printf("Total: %d\n", Count),

dna(DNA,ChunkSize) =>
  ChunkSize = 50.

Base count:
    A: 129
    C:  97
    G: 119
    T: 155
Total: 500


      R )
   (for I S (accu 'R I 1))
   (for I R (println I))
   (println 'Total: (sum cdr R)) )
("A" . 129)
("T" . 155)
("G" . 119)
("C" . 97)
Total: 500



NewMap basecount.i()

If OpenConsole("")
  For i = 1 To Len(dna$)
    If (i % 50) = 1
      Print(~"\n" + RSet(Str(i - 1), 5) + " : ")
    t$ = Mid(dna$, i, 1)
    basecount(t$) + 1
  PrintN(~"\n\n" + Space(2) + "Base  count")
  PrintN(Space(2) + ~"----  -----")
  ForEach basecount()
    PrintN(RSet(MapKey(basecount()), 5) + " : " + RSet(Str(basecount()), 5))
    sigma + basecount()
  PrintN(~"\n" + "Total = " + RSet(Str(sigma), 5))

  Base  count
  ----  -----
    A :   129
    C :    97
    G :   119
    T :   155

Total =   500



from collections import Counter

def basecount(dna):
    return sorted(Counter(dna).items())

def seq_split(dna, n=50):
    return [dna[i: i+n] for i in range(0, len(dna), n)]

def seq_pp(dna, n=50):
    for i, part in enumerate(seq_split(dna, n)):
        print(f"{i*n:>5}: {part}")
    print("\n  BASECOUNT:")
    tot = 0
    for base, count in basecount(dna):
        print(f"    {base:>3}: {count}")
        tot += count
    base, count = 'TOT', tot
    print(f"    {base:>3}= {count}")
if __name__ == '__main__':
    sequence = '''\

      A: 129
      C: 97
      G: 119
      T: 155
    TOT= 500

procedural ( dictionary version)

Works with: Python version 3.10.5
	Python 3.10.5 (main, Jun  6 2022, 18:49:26) [GCC 12.1.0] on linux

	Created on Wed 2022/08/17 11:19:31

def main ():

	def DispCount () :

	    return f'\n\nBases :\n\n' + f''.join ( [ f'{i} =\t{D [ i ]:4d}\n' for i in  sorted ( BoI ) ] )


	All   = set( S ) 
	BoI   = set ( [ "A","C","G","T" ] )
	other = All - BoI
	D     = { k : S.count ( k ) for k in All }
	print ( 'Sequence:\n\n')

	print ( ''.join ( [ f'{k:4d} : {S [ k: k + 50 ]}\n' for k in range ( 0, len ( S ), 50 ) ] ) )

	print ( f'{DispCount ()} \n------------')

	print ( '' if ( other == set () ) else f'Other\t{sum ( [ D [ k ] for k in sorted ( other ) ] ):4d}\n\n' )

	print ( f'Σ = \t {sum ( [ D [ k ] for k in sorted ( All ) ] ) } \n============\n')

def test ():



LIVE = True

if ( __name__ == '__main__' ) :

	main () if LIVE else test ()
JPD 2022/08/17


Bases :

A =      129
C =       97
G =      119
T =      155
Σ =      500


Sequence and base counts displayed in GenBank format.

Works with: Python version 3.7
'''Bioinformatics – base count'''

from itertools import count
from functools import reduce

# genBankFormatWithBaseCounts :: String -> String
def genBankFormatWithBaseCounts(sequence):
    '''DNA Sequence displayed in a subset of the GenBank format.
       See example at foot of:
    ks, totals = zip(*baseCounts(sequence))
    ns = list(map(str, totals))
    w = 2 + max(map(len, ns))

    return '\n'.join([
        'DEFINITION  len=' + str(sum(totals)),
        'BASE COUNT  ' + ''.join(
            n.rjust(w) + ' ' + k.lower() for (k, n)
            in zip(ks, ns)
    ] + [
        str(i).rjust(9) + ' ' + k for i, k
        in zip(
            count(1, 60),
                ' '.join(row) for row in
    ] + ['//'])

# baseCounts :: String -> Zip [(String, Int)]
def baseCounts(baseString):
    '''Sums for each base type in the given sequence string, with
       a fifth sum for any characters not drawn from {A, C, G, T}.'''
    bases = {
        'A': 0,
        'C': 1,
        'G': 2,
        'T': 3
    return zip(
        list(bases.keys()) + ['Other'],
            lambda a: compose(
        )((0, 0, 0, 0, 0))(baseString)

# -------------------------- TEST --------------------------
# main :: IO ()
def main():
    '''Base counts and sequence displayed in GenBank format

# ------------------------ GENERIC -------------------------

# chunksOf :: Int -> [a] -> [[a]]
def chunksOf(n):
    '''A series of lists of length n, subdividing the
       contents of xs. Where the length of xs is not evenly
       divible, the final list will be shorter than n.
    return lambda xs: reduce(
        lambda a, i: a + [xs[i:n + i]],
        range(0, len(xs), n), []
    ) if 0 < n else []

# compose :: ((a -> a), ...) -> (a -> a)
def compose(*fs):
    '''Composition, from right to left,
       of a series of functions.
    def go(f, g):
        def fg(x):
            return f(g(x))
        return fg
    return reduce(go, fs, lambda x: x)

# curry :: ((a, b) -> c) -> a -> b -> c
def curry(f):
    '''A curried function derived
       from an uncurried function.
    return lambda x: lambda y: f(x, y)

# flip :: (a -> b -> c) -> b -> a -> c
def flip(f):
    '''The (curried or uncurried) function f with its
       arguments reversed.
    return lambda a: lambda b: f(b)(a)

# foldl :: (a -> b -> a) -> a -> [b] -> a
def foldl(f):
    '''Left to right reduction of a list,
       using the binary operator f, and
       starting with an initial value a.
    def go(acc, xs):
        return reduce(lambda a, x: f(a)(x), xs, acc)
    return lambda acc: lambda xs: go(acc, xs)

# nthArrow :: (a -> b) -> Tuple -> Int -> Tuple
def nthArrow(f):
    '''A simple function lifted to one which applies
       to a tuple, transforming only its nth value.
    def go(v, n):
        return v if n > len(v) else [
            x if n != i else f(x)
            for i, x in enumerate(v)
    return lambda tpl: lambda n: tuple(go(tpl, n))

# succ :: Enum a => a -> a
def succ(x):
    '''The successor of a value.
       For numeric types, (1 +).
    return 1 + x

# MAIN ---
if __name__ == '__main__':
BASE COUNT    129 a   97 c  119 g  155 t    0 other


  [ over size - 
    space swap of
    swap join ]                 is justify     ( $ n --> $ )

  [ 0 swap 
    [ dup $ "" != while
      cr over number$ 
      4 justify echo$
      5 times 
        [ dup $ "" = iff 
            conclude done
          10 split swap echo$ ] 
       dip [ 50 + ] again ]
      2drop ]                   is prettyprint (   $ -->   )

   [ stack ]                    is adenine     (     --> s )
   [ stack ]                    is cytosine    (     --> s )
   [ stack ]                    is guanine     (     --> s )
   [ stack ]                    is thymine     (     --> s )

   [ table
     adenine cytosine 
     guanine thymine ]          is bases       (     --> [ )     

  [ 4 times
      [ 0 i^ bases put ] 
      [ $ "ACGT" find bases 
        1 swap tally ]
      4 times
        [ sp 
          i^ bases dup echo
          sp share echo cr ]
      0 4 times 
        [ i^ bases take + ]
      cr say " total " echo ]   is tallybases  (   [ -->   ) 
 dup prettyprint cr cr tallybases

 adenine 129
 cytosine 97
 guanine 119
 thymine 155

 total 500



gene2 <- gsub("\n", "", gene1) #remove \n chars
gene3 <- strsplit(gene2, split = character(0)) #split into list
gene4 <- gene3[[1]] #pull out character vector from list
basecounts <- #make table of base counts

#quick helper function to print table results
print_row <- function(df, row){paste0(df$gene[row],": ", df$Freq[row])}

#Print Function for Data with Results:
cat(" Data: \n",
    "  1:",substring(gene2, 1, 50),"\n",
    " 51:",substring(gene2, 51, 100),"\n",
    "101:",substring(gene2, 101, 150),"\n",
    "151:",substring(gene2, 151, 200),"\n",
    "201:",substring(gene2, 201, 250),"\n",
    "251:",substring(gene2, 251, 300),"\n",
    "301:",substring(gene2, 301, 350),"\n",
    "351:",substring(gene2, 351, 400),"\n",
    "401:",substring(gene2, 401, 450),"\n",
    "451:",substring(gene2, 451, 500),"\n", 
    "Base Count Results: \n",
    print_row(basecounts,1), "\n",
    print_row(basecounts,2), "\n",
    print_row(basecounts,3), "\n",
    print_row(basecounts,4), "\n",
    "Total Base Count:", paste(length(gene4)) 

 Base Count Results: 
 A: 129 
 C: 97 
 G: 119 
 T: 155 
 Total Base Count: 500


#lang racket

(define (fold-sequence seq kons #:finalise (finalise (λ x (apply values x))) . k0s)
  (define (recur seq . ks)
    (if (null? seq)
      (call-with-values (λ () (apply finalise ks)) (λ vs (apply values vs)))
      (call-with-values (λ () (apply kons (car seq) ks)) (λ ks+ (apply recur (cdr seq) ks+)))))
  (apply recur (if (string? seq) (string->list (regexp-replace* #px"[^ACGT]" seq "")) seq) k0s))

(define (sequence->pretty-printed-string seq)
  (define (fmt idx cs-rev) (format "~a: ~a" (~a idx #:width 3 #:align 'right) (list->string (reverse cs-rev))))
    (λ (b n start-idx lns-rev cs-rev)
       (if (zero? (modulo n 50))
	 (values (+ n 1) n (if (pair? cs-rev) (cons (fmt start-idx cs-rev) lns-rev) lns-rev) (cons b null))
	 (values (+ n 1) start-idx lns-rev (cons b cs-rev))))
    0 0 null null
    #:finalise (λ (n idx lns-rev cs-rev)
		(string-join (reverse (if (null? cs-rev) lns-rev (cons (fmt idx cs-rev) lns-rev))) "\n"))))

(define (count-bases b as cs gs ts n)
  (values (+ as (if (eq? b #\A) 1 0))
	  (+ cs (if (eq? b #\C) 1 0))
	  (+ gs (if (eq? b #\T) 1 0))
	  (+ ts (if (eq? b #\G) 1 0))
	  (add1 n)))

(define (bioinformatics-Base_count s)
  (define-values (as cs gs ts n) (fold-sequence s count-bases 0 0 0 0 0))
  (printf "SEQUENCE:~%~%~a~%~%" (sequence->pretty-printed-string s))
  (printf "BASE COUNT:~%-----------~%~%~a~%~%"
	  (string-join (map (λ (c n) (format " ~a :~a" c (~a #:width 4 #:align 'right n)))
			    '(A T C G)
			    (list as ts cs gs)) "\n"))
  (printf "TOTAL: ~a~%" n))

  (define the-string
  (bioinformatics-Base_count the-string))



 A : 129
 T : 119
 C :  97
 G : 155

TOTAL: 500


(formerly Perl 6)

Works with: Rakudo version 2019.07.1

It's the Letter frequency task all over again, just simpler and dressed up in different clothes.

The specs for what "pretty print" means are sadly lacking. Ah well, just makes it easily defensible if I do anything at all.

my $dna = join '', lines q:to/END/;

put pretty($dna, 80);
put "\nTotal bases: ", +my $bases = $dna.comb.Bag;
put $bases.sort(~*.key).join: "\n";

sub pretty ($string, $wrap = 50) {
    $string.comb($wrap).map( { sprintf "%8d: %s", $++ * $wrap, $_ } ).join: "\n"

Total bases: 500
A	129
C	97
G	119
T	155


A little extra boilerplate was added to verify correct coding of the bases in a DNA string and the alignment of the (totals) numbers.

/*REXX program finds the number of each  base  in a  DNA  string  (along with a total). */
parse arg dna .
if dna==''   | dna==","  then dna= 'cgtaaaaaattacaacgtcctttggctatctcttaaactcctgctaaatg'  ,
                                   'ctcgtgctttccaattatgtaagcgttccgagacggggtggtcgattctg'  ,
                                   'aggacaaaggtcaagatggagcgcatcgaacgcaataaggatcatttgat'  ,
                                   'gggacgtttcgtcgacaaagtcttgtttcgagagtaacggctaccgtctt'  ,
                                   'cgattctgcttataacactatgttcttatgaaatggatgttctgagttgg'  ,
                                   'tcagtcccaatgtgcggggtttcttttagtacgtcgggagtggtattata'  ,
                                   'tttaatttttctatatagcgatctgtatttaagcaattcatttaggttat'  ,
                                   'cgccgcgatgctcggttcggaccgccaagcatctggctccactgctagtg'  ,
                                   'tcctaaatttgaatggcaaacacaaataagatttagcaattcgtgtagac'  ,
dna= space(dna, 0);  upper dna                   /*elide blanks from DNA; uppercase it. */
say '────────length of the DNA string: '   length(dna)
@.= 0                                            /*initialize the count for all bases.  */
w= 1                                             /*the maximum width of a base count.   */
$=                                               /*a placeholder for the names of bases.*/
       do j=1  for length(dna)                   /*traipse through the  DNA  string.    */
       _= substr(dna, j, 1)                      /*obtain a base name from the DNA str. */
       if pos(_, $)==0  then $= $  ||  _         /*if not found before, add it to list. */
       @._= @._ + 1                              /*bump the count of this base.         */
       w= max(w, length(@._) )                   /*compute the maximum width number.    */
       end   /*j*/
       do k=0  for 255;   z= d2c(k)              /*traipse through all possibilities.   */
       if pos(z, $)==0  then iterate             /*Was this base found?  No, then skip. */
       say '     base '   z    " has a basecount of: "   right(@.z, w)
       @.tot= @.tot + @.z                        /*add to a grand total to verify count.*/
       end   /*k*/                               /*stick a fork in it,  we're all done. */
say '────────total for all basecounts:'                  right(@.tot, w+1)
output   when using the default input:
────────length of the DNA string:  500

     base  A  has a basecount of:  129
     base  C  has a basecount of:   97
     base  G  has a basecount of:  119
     base  T  has a basecount of:  155

────────total for all basecounts:  500


dna = "" +

dnaBase = [:A=0, :C=0, :G=0, :T=0]
lenDna = len(dna)
for n = 1 to lenDna
    dnaStr = substr(dna,n,1)
    switch dnaStr
           on "A"
              strA = dnaBase["A"]
              dnaBase["A"] = strA
           on "C"
              strC = dnaBase["C"]
              dnaBase["C"] = strC
           on "G"
              strG = dnaBase["G"]
              dnaBase["G"] = strG
           on "T"
              strT = dnaBase["T"]
              dnaBase["T"] = strT
? "A : " + dnaBase["A"] 
? "T : " + dnaBase["T"]
? "C : " + dnaBase["C"]
? "G : " + dnaBase["G"]
A : 129
T : 155
C : 97
G : 119


dna = <<DNA_STR

chunk_size = 60
dna        = dna.delete("\n")
size       = dna.size

0.step(size, chunk_size) do |pos|
  puts "#{pos.to_s.ljust(6)} #{dna[pos, chunk_size]}"

puts{|ar| ar.join(" : ") }
puts "Total : #{dna.size}"
A : 129
C : 97
G : 119
T : 155
Total : 500


use std::collections::HashMap;

fn main() {

    let mut base_count = HashMap::new();
    let mut total_count = 0;
    for base in dna.chars() {
        if total_count % 50 == 0 {
            print!("\n{:3}: ", total_count);
        print!("{}", base);
        total_count += 1;
        let count = base_count.entry(base).or_insert(0); // Return current count for base or insert 0
        *count += 1;
    println!("Base count:");

    let mut base_count: Vec<_> = base_count.iter().collect(); // HashMaps can't be sorted, so collect into Vec
    base_count.sort_by_key(|bc| bc.0); // Sort bases alphabetically
    for (base, count) in base_count.iter() {
        println!("  {}: {:3}", base, count);
    println!("Total: {}", total_count);

Base count:
  A: 129
  C:  97
  G: 119
  T: 155

Total: 500


import Foundation

let dna = """


let counts =
  dna.replacingOccurrences(of: "\n", with: "").reduce(into: [:], { $0[$1, default: 0] += 1 })

print("Counts: \(counts)")
print("Total: \(counts.values.reduce(0, +))")

["C": 97, "T": 155, "G": 119, "A": 129]
Total: 500


namespace path ::tcl::mathop

proc process {data {width 50}} {
	set len [string length $data]
	set addrwidth [string length [* [/ $len $width] $width]]
	for {set i 0} {$i < $len} {incr i $width} {
		puts "[format %${addrwidth}u $i] [string range $data $i $i+[- $width 1]]"
	puts "\nBase count:"
	foreach base {A C G T} {
		puts "$base     [regexp -all $base $data]"
	puts "Total $len"

set test [string cat \
process $test 50

Base count:
A     129
C     97
G     119
T     155
Total 500



for i=0 to len(b)-1
  if (i mod 30)=0 then s = s & vbcrlf & right("   "& i+1,3)&": " 
  if (i mod 5)=0 then s=s& " "
  s=s & m
  select case m
  case "A":acnt=acnt+1
  case "C":ccnt=ccnt+1
  case "G":gcnt=gcnt+1
  case "T":tcnt=tcnt+1
  case else
     wscript.echo "error at ",i+1, m 
  end select
wscript.echo s & vbcrlf
wscript.echo "Count: A="&acnt & " C=" & ccnt & " G=" & gcnt & " T=" & tcnt

Count: A=129 C=97 G=119 T=155


Translation of: go
fn main() {
    dna := "" +
    le := dna.len
    for i := 0; i < le; i += 50 {
        mut k := i + 50
        if k > le {
            k = le
        println("${i:5}: ${dna[i..k]}")
    mut base_map := map[byte]int{} // allows for 'any' base
    for i in 0..le {
    mut bases := base_map.keys()
    println("\nBASE COUNT:")
    for base in bases {
        println("    $base: ${base_map[base]:3}")
    println("    ------")
    println("    Σ: $le")
    println("    ======")

    A: 129
    C:  97
    G: 119
    T: 155
    Σ: 500


Translation of: Go
Library: Wren-fmt
Library: Wren-sort
Library: Wren-trait
import "/fmt" for Fmt
import "/sort" for Sort
import "/trait" for Stepped


var le = dna.count
for (i in, 50)) {
    var k = i + 50
    if (k > le) k = le
    System.print("%(Fmt.d(5, i)): %(dna[i...k])")
var baseMap = {} // allows for 'any' base
for (i in 0...le) {
    var d = dna[i]
    var v = baseMap[d]
    baseMap[d] = !v ? 1 : v + 1
var bases = baseMap.keys.toList

System.print("\nBASE COUNT:")
for (base in bases) {
    System.print("    %(base): %(Fmt.d(3, baseMap[base]))")
System.print("    ------")
System.print("    Σ: %(le)")
System.print("    ======")

    A: 129
    C:  97
    G: 119
    T: 155
    Σ: 500


char    Bases;
int     Counts(256), Cnt, I, Ch;
[Bases:= "

for I:= 0 to 255 do Counts(I):= 0;
Format(5, 0);
Cnt:= 0;
I:= 0;
loop    [repeat Ch:= Bases(I);
                I:= I+1;
                if Ch = ^x then quit;
                Counts(Ch):= Counts(Ch)+1;
                ChOut(0, Ch);
        until   Ch = \LF\$0A;
        RlOut(0, float(Cnt));  Text(0, ": ");
        Cnt:= Cnt + 50;
CrLf(0);  CrLf(0);
Text(0, "Base counts A: ");  IntOut(0, Counts(^A));
Text(0, " C: ");  IntOut(0, Counts(^C));
Text(0, " G: ");  IntOut(0, Counts(^G));
Text(0, " T: ");  IntOut(0, Counts(^T));
Text(0, "
Total: ");  IntOut(0, Cnt);  CrLf(0);


Base counts A: 129 C: 97 G: 119 T: 155
Total: 500



[0..*,50].zipWith(fcn(n,bases){ println("%6d: %s".fmt(n,bases.concat())) },
   bases.walker().walk.fp(50)).pump(Void);  // .pump forces the iterator

println("\nBase Counts: ", bases.counts().pump(String,Void.Read,"%s: %d  ".fmt));
println("Total: ",bases.len());

Base Counts: A: 129  C: 97  G: 119  T: 155  
Total: 500