Knuth-Morris-Pratt string search: Difference between revisions
m (→{{header|J}}: trivial optimization) |
(Add Python) |
||
Line 270: | Line 270: | ||
Found `and` in `Inhisbooks...epresented (202 characters)` three times at {102,129,172} (216 character comparisons) |
Found `and` in `Inhisbooks...epresented (202 characters)` three times at {102,129,172} (216 character comparisons) |
||
Found `alfalfa` in `Nearby far... for milk. (114 characters)` twice at {34,88} (125 character comparisons) |
Found `alfalfa` in `Nearby far... for milk. (114 characters)` twice at {34,88} (125 character comparisons) |
||
</pre> |
|||
=={{header|Python}}== |
|||
Based on pseudocode found in the [https://en.wikipedia.org/wiki/Knuth%E2%80%93Morris%E2%80%93Pratt_algorithm Wikipedia article]. Uses test cases from the [[#Wren]] solution. |
|||
<lang python>"""Knuth-Morris-Pratt string search. Requires Python >= 3.7.""" |
|||
from typing import List |
|||
from typing import Tuple |
|||
def kmp_search(text: str, word: str) -> Tuple[List[int], int]: |
|||
text_position = 0 |
|||
word_position = 0 |
|||
positions: List[int] = [] |
|||
number_of_positions = 0 |
|||
table = kmp_table(word) |
|||
while text_position < len(text): |
|||
if word[word_position] == text[text_position]: |
|||
text_position += 1 |
|||
word_position += 1 |
|||
if word_position == len(word): |
|||
positions.append(text_position - word_position) |
|||
number_of_positions += 1 |
|||
word_position = table[word_position] |
|||
else: |
|||
word_position = table[word_position] |
|||
if word_position < 0: |
|||
text_position += 1 |
|||
word_position += 1 |
|||
return positions, number_of_positions |
|||
def kmp_table(word: str) -> List[int]: |
|||
position = 1 |
|||
candidate = 0 |
|||
table = [0] * (len(word) + 1) |
|||
table[0] = -1 |
|||
while position < len(word): |
|||
if word[position] == word[candidate]: |
|||
table[position] = table[candidate] |
|||
else: |
|||
table[position] = candidate |
|||
while candidate >= 0 and word[position] != word[candidate]: |
|||
candidate = table[candidate] |
|||
position += 1 |
|||
candidate += 1 |
|||
table[position] = candidate |
|||
return table |
|||
TEST_CASES = [ |
|||
("GCTAGCTCTACGAGTCTA", "TCTA"), |
|||
("GGCTATAATGCGTA", "TAATAAA"), |
|||
("there would have been a time for such a word", "word"), |
|||
("needle need noodle needle", "needle"), |
|||
( |
|||
( |
|||
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesley" |
|||
"DKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeand" |
|||
"assemblylanguagestoillustratetheconceptsandalgorithmsastheyare" |
|||
"presented" |
|||
), |
|||
"put", |
|||
), |
|||
( |
|||
( |
|||
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesley" |
|||
"DKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeand" |
|||
"assemblylanguagestoillustratetheconceptsandalgorithmsastheyare" |
|||
"presented" |
|||
), |
|||
"and", |
|||
), |
|||
( |
|||
( |
|||
"Nearby farms grew a half acre of alfalfa on the dairy's behalf, " |
|||
"with bales of all that alfalfa exchanged for milk." |
|||
), |
|||
"alfalfa", |
|||
), |
|||
] |
|||
def main(): |
|||
for text, word in TEST_CASES: |
|||
positions, number_of_positions = kmp_search(text, word) |
|||
if number_of_positions == 0: |
|||
print(f"`{word}` not found in `{text[:10]}...`") |
|||
elif number_of_positions == 1: |
|||
print(f"Found `{word}` in `{text[:10]}...` once at {positions}.") |
|||
else: |
|||
print( |
|||
f"Found `{word}` in `{text[:10]}...` {number_of_positions} times at {positions}." |
|||
) |
|||
if __name__ == "__main__": |
|||
main() |
|||
</lang> |
|||
{{out}} |
|||
<pre> |
|||
Found `TCTA` in `GCTAGCTCTA...` 2 times at [6, 14]. |
|||
`TAATAAA` not found in `GGCTATAATG...` |
|||
Found `word` in `there woul...` once at [40]. |
|||
Found `needle` in `needle nee...` 2 times at [0, 19]. |
|||
Found `put` in `Inhisbooks...` 2 times at [26, 90]. |
|||
Found `and` in `Inhisbooks...` 3 times at [101, 128, 171]. |
|||
Found `alfalfa` in `Nearby far...` 2 times at [33, 87]. |
|||
</pre> |
</pre> |
||
Revision as of 16:27, 22 July 2022
< About Knuth-Morris-Pratt String Search Algorithm >
Emacs Lisp
<lang lisp> (defun kmp_compile_pattern (pattern)
"Compile pattern to DFA."
(defun create-2d-array (x y init) (let ((arr1 (make-vector x nil))) (dotimes (i x)
(aset arr1 i (make-vector y init)) )
arr1 ) ) (let* ((patLen (length pattern))
(R 256)
(restartPos 0)
(dfa (create-2d-array R patLen 0)))
(aset (aref dfa (elt pattern 0)) 0 1)
(let ((patPos 0)) (while (progn (setq patPos (1+ patPos)) (< patPos patLen))
(dotimes (c R) (aset (aref dfa c) patPos (aref (aref dfa c) restartPos)) )
(aset (aref dfa (elt pattern patPos)) patPos (1+ patPos)) (setq restartPos (aref (aref dfa (elt pattern patPos)) restartPos) ) )
) dfa ) )
(defun kmp_search (pattern text)
"Pattern search with KMP algorithm." (let ((dfa (kmp_compile_pattern pattern)))
(let ((textPos 0) (patPos 0) (N (length text)) (M (length pattern))) (while (and (< textPos N) (< patPos M))
(setq patPos (aref (aref dfa (elt text textPos)) patPos)) (setq textPos (1+ textPos)) )
(if (= patPos M) (- textPos M) N ) ) ) )
</lang>
J
Implementation:<lang J>kmp_table=: {{
j=. 0 T=. _1 for_ch. }.y do. if. ch=j{y do. T=. T,j{T else. T=. T,j while. (0<:j) * ch~:j{y do. j=. j{T end. end. j=. j+1 end. T=. T, j
}}
kmp_search=: Template:B=. 0</lang>
Task examples:<lang J> text1=: 'InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented'
text2=: 'Nearby farms grew a half acre of alfalfa on the dairys behalf, with bales of all that alfalfa exchanged for milk.' 'put' kmp_search text1
26 90
'and' kmp_search text1
101 128 171
'and' kmp_search text2
'alfalfa' kmp_search text2
33 87</lang>
(J uses index 0 for the first character in a sequence of characters.)
Julia
<lang ruby>"""
function kmp_table(W)
input:
an array of characters, W (the word to be analyzed)
output:
an array of integers, T (the table to be filled)
define variables:
an integer, i ← 2 (the current one-based position we are computing in T) an integer, j ← 0 (the additive to index i in W of the next character of the current candidate substring)
""" function kmp_table(W)
len = length(W) T = zeros(Int, len) # start with the second letter of W, looking for patterns in W i = 2 while i < len j = 0 while i + j <= len # avoid overshooting end with index # compute the longest proper prefix if W[i + j] == W[j + 1] T[i + j] = T[i + j - 1] + 1 else T[i + j] = 0 # back to start j += 1 break end j += 1 end # entry in T found, so begin at next starting point along W i += j end return T
end
"""
function kmp_search(S, W)
input:
an array of characters, S (the text to be searched) an array of characters, W (the word sought)
output:
an array of integers, P (positions in S at which W is found)
define variables (one based indexing in Julia differs from the Wikipedia example):
an integer, i ← 1 (the position of the current character in S) an integer, j ← 1 (the position of the current character in W) an array of integers, T (the table, computed elsewhere)
""" function kmp_search(S, W)
lenW, lenS = length(W), length(S) i, P = 1, Int[] T = kmp_table(W) # get pattern table while i <= lenS - lenW + 1 for j in 1:lenW if S[i + j - 1] != W[j] # pattern not found, so skip unnecessary inner loops i += T[j] + 1 @goto next_outer_loop end end # found pattern W in S, so add to output P push!(P, i) i += 1 @label next_outer_loop end return P
end
const text1 = "InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented" const text2 = "Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk." const pat1, pat2, pat3 = "put", "and", "alfalfa"
println("Found <$pat1> at: (one-based indices) ", kmp_search(text1, pat1)) println("Found <$pat2> at: (one-based indices) ", kmp_search(text1, pat2)) println("Found <$pat3> at: (one-based indices) ", kmp_search(text2, pat3))
</lang>
- Output:
Found <put> at: (one-based indices) [27, 91] Found <and> at: (one-based indices) [102, 129, 172] Found <alfalfa> at: (one-based indices) [34, 88]
Phix
-- -- demo\rosetta\KnuthMorrisPratt.exw -- ================================= -- -- based on https://www-igm.univ-mlv.fr/~lecroq/string/node8.html#SECTION0080 -- with javascript_semantics function preKmp(string pat) integer m = length(pat), i = 1, j = 0 sequence kmpNext = repeat(-1,m+1) pat &= '\0' while i <= m do while j > 0 and pat[i] != pat[j] do j = kmpNext[j]+1 end while i += 1 j += 1 if pat[i] == pat[j] then kmpNext[i] = kmpNext[j] else kmpNext[i] = j-1 end if end while return kmpNext end function procedure KMP(string pat, s, bool case_insensitive = false) string pins = sprintf("`%s` in `%s`",{pat,shorten(s,"characters",10)}) if case_insensitive then {pat,s} = lower({pat,s}) end if /* Preprocessing */ sequence kmpNext = preKmp(pat) /* Searching */ sequence res = {} integer i = 0, j = 0, n = length(s), m = length(pat), cc = 0 while j < n do while i > -1 do cc += 1 if pat[i+1] = s[j+1] then exit end if i = kmpNext[i+1] end while i += 1 j += 1 if i >= m then res &= j-i+1 i = kmpNext[i+1] end if end while /* Output */ string ccs = sprintf("(%d character comparisons)",cc) if length(res) then string many = ordinant(length(res)) printf(1,"Found %s %s at %v %s\n",{pins,many,res,ccs}) else printf(1,"No %s %s\n",{pins,ccs}) end if end procedure KMP("GCAGAGAG","GCATCGCAGAGAGTATACAGTACG") KMP("TCTA","GCTAGCTCTACGAGTCTA") KMP("TAATAAA","GGCTATAATGCGTA") KMP("word","there would have been a time for such a word") KMP("needle","needle need noodle needle") constant book = "InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesley"& "DKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeand"& "assemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented" KMP("put",book) KMP("and",book) constant farm = "Nearby farms grew a half acre of alfalfa on the dairy's behalf, with "& "bales of all that alfalfa exchanged for milk." KMP("alfalfa",farm) --KMP("aLfAlfa",farm) -- none --KMP("aLfAlfa",farm,true) -- as -2
- Output:
Significantly higher character comparison counts than Boyer-Moore_string_search#Phix.
Also higher than those on the above (lecroq) link, probably because this carries on for all matches.
Found `GCAGAGAG` in `GCATCGCAGAGAGTATACAGTACG` once at {6} (26 character comparisons) Found `TCTA` in `GCTAGCTCTACGAGTCTA` twice at {7,15} (19 character comparisons) No `TAATAAA` in `GGCTATAATGCGTA` (16 character comparisons) Found `word` in `there woul...uch a word (44 characters)` once at {41} (45 character comparisons) Found `needle` in `needle need noodle needle` twice at {1,20} (27 character comparisons) Found `put` in `Inhisbooks...epresented (202 characters)` twice at {27,91} (205 character comparisons) Found `and` in `Inhisbooks...epresented (202 characters)` three times at {102,129,172} (216 character comparisons) Found `alfalfa` in `Nearby far... for milk. (114 characters)` twice at {34,88} (125 character comparisons)
Python
Based on pseudocode found in the Wikipedia article. Uses test cases from the #Wren solution. <lang python>"""Knuth-Morris-Pratt string search. Requires Python >= 3.7.""" from typing import List from typing import Tuple
def kmp_search(text: str, word: str) -> Tuple[List[int], int]:
text_position = 0 word_position = 0
positions: List[int] = [] number_of_positions = 0 table = kmp_table(word)
while text_position < len(text): if word[word_position] == text[text_position]: text_position += 1 word_position += 1 if word_position == len(word): positions.append(text_position - word_position) number_of_positions += 1 word_position = table[word_position] else: word_position = table[word_position] if word_position < 0: text_position += 1 word_position += 1
return positions, number_of_positions
def kmp_table(word: str) -> List[int]:
position = 1 candidate = 0
table = [0] * (len(word) + 1) table[0] = -1
while position < len(word): if word[position] == word[candidate]: table[position] = table[candidate] else: table[position] = candidate while candidate >= 0 and word[position] != word[candidate]: candidate = table[candidate] position += 1 candidate += 1
table[position] = candidate return table
TEST_CASES = [
("GCTAGCTCTACGAGTCTA", "TCTA"), ("GGCTATAATGCGTA", "TAATAAA"), ("there would have been a time for such a word", "word"), ("needle need noodle needle", "needle"), ( ( "InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesley" "DKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeand" "assemblylanguagestoillustratetheconceptsandalgorithmsastheyare" "presented" ), "put", ), ( ( "InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesley" "DKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeand" "assemblylanguagestoillustratetheconceptsandalgorithmsastheyare" "presented" ), "and", ), ( ( "Nearby farms grew a half acre of alfalfa on the dairy's behalf, " "with bales of all that alfalfa exchanged for milk." ), "alfalfa", ),
]
def main():
for text, word in TEST_CASES: positions, number_of_positions = kmp_search(text, word)
if number_of_positions == 0: print(f"`{word}` not found in `{text[:10]}...`") elif number_of_positions == 1: print(f"Found `{word}` in `{text[:10]}...` once at {positions}.") else: print( f"Found `{word}` in `{text[:10]}...` {number_of_positions} times at {positions}." )
if __name__ == "__main__":
main()
</lang>
- Output:
Found `TCTA` in `GCTAGCTCTA...` 2 times at [6, 14]. `TAATAAA` not found in `GGCTATAATG...` Found `word` in `there woul...` once at [40]. Found `needle` in `needle nee...` 2 times at [0, 19]. Found `put` in `Inhisbooks...` 2 times at [26, 90]. Found `and` in `Inhisbooks...` 3 times at [101, 128, 171]. Found `alfalfa` in `Nearby far...` 2 times at [33, 87].
Wren
This is based on the code here. The examples used are the same as in the Boyer-Moore_string_search#Wren task. <lang ecmascript>class KMP {
static search(haystack, needle) { haystack = haystack.bytes.toList needle = needle.bytes.toList var hc = haystack.count var nc = needle.count var indices = [] var i = 0 // index into haystack var j = 0 // index into needle var t = table_(needle) while (i < hc) { if (needle[j] == haystack[i]) { i = i + 1 j = j + 1 } if (j == nc) { indices.add(i - j) j = t[j-1] } else if (i < hc && needle[j] != haystack[i]) { if (j != 0) { j = t[j-1] } else { i = i + 1 } } } return indices }
static table_(needle) { var nc = needle.count var t = List.filled(nc, 0) var i = 1 // index into table var len = 0 // length of previous longest prefix while (i < nc) { if (needle[i] == needle[len]) { len = len + 1 t[i] = len i = i + 1 } else if (len != 0) { len = t[len-1] } else { t[i] = 0 i = i + 1 } } return t }
}
var texts = [
"GCTAGCTCTACGAGTCTA", "GGCTATAATGCGTA", "there would have been a time for such a word", "needle need noodle needle",
"InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented",
"Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk."
] var pats = ["TCTA", "TAATAAA", "word", "needle", "put", "and", "alfalfa"] for (i in 0...texts.count) System.print("text%(i+1) = %(texts[i])") System.print() for (i in 0...pats.count) {
var j = (i < 5) ? i : i-1 System.print("Found '%(pats[i])' in 'text%(j+1)' at indices %(KMP.search(texts[j], pats[i]))")
}</lang>
- Output:
text1 = GCTAGCTCTACGAGTCTA text2 = GGCTATAATGCGTA text3 = there would have been a time for such a word text4 = needle need noodle needle text5 = InhisbookseriesTheArtofComputerProgrammingpublishedbyAddisonWesleyDKnuthusesanimaginarycomputertheMIXanditsassociatedmachinecodeandassemblylanguagestoillustratetheconceptsandalgorithmsastheyarepresented text6 = Nearby farms grew a half acre of alfalfa on the dairy's behalf, with bales of all that alfalfa exchanged for milk. Found 'TCTA' in 'text1' at indices [6, 14] Found 'TAATAAA' in 'text2' at indices [] Found 'word' in 'text3' at indices [40] Found 'needle' in 'text4' at indices [0, 19] Found 'put' in 'text5' at indices [26, 90] Found 'and' in 'text5' at indices [101, 128, 171] Found 'alfalfa' in 'text6' at indices [33, 87]