Bioinformatics/Global alignment: Difference between revisions

From Rosetta Code
Content added Content deleted
Line 178:
_________________
Total length 300
</pre>
 
=={{header|Phix}}==
<lang Phix>requires("0.8.4") -- (or the trivial 7/2/21 bugfix in punique.e)
 
procedure printcounts(sequence ss)
-- Given DNA sequence(s), report the sequence, length and base counts
for i=1 to length(ss) do
string dna = ss[i]
sequence acgt = repeat(0,6)
for j=1 to length(dna) do
acgt[find(dna[j],"ACGT")+1] += 1
end for
acgt[$] = sum(acgt)
string ncf = "Nucleotide counts for :"
printf(1,"%s%s\n",{ncf,join(split_by(dna,50),"\n"&repeat(' ',length(ncf)))})
printf(1,"\nBase counts: Other:%d, A:%d, C:%d, G:%d, T:%d, total:%d\n\n",acgt)
end for
end procedure
function deduplicate(sequence ss)
-- Remove duplicates and strings contained within a larger string from vector of strings
sequence filtered = {}
for i=1 to length(ss) do
string si = ss[i]
bool found = false
for j=1 to length(ss) do
if i!=j and match(si,ss[j]) then
found = true
exit
end if
end for
if not found then
filtered = append(filtered, si)
end if
end for
return filtered
end function
procedure shortest_common_superstring(sequence ss)
-- Returns shortest common superstring of a vector of strings
ss = deduplicate(unique(ss,"STABLE"))
sequence shortestsuper = {join(ss,"")}
integer shortest = length(shortestsuper[1])
for p=1 to factorial(length(ss)) do
sequence perm = permute(p,ss)
string sup = perm[1]
for i=2 to length(perm) do
string pi = perm[i]
for j=-min(length(pi),length(sup)) to 0 do
string overlap = sup[j..$]
if overlap = pi[1..length(overlap)] then
sup &= pi[length(overlap)+1..$]
pi = ""
exit
end if
end for
if length(pi) then ?9/0 end if -- (sanity chk)
end for
if length(sup) < shortest then
shortest = length(sup)
shortestsuper = {sup}
elsif length(sup) = shortest
and not find(sup,shortestsuper) then
shortestsuper = append(shortestsuper,sup)
end if
end for
printcounts(shortestsuper)
end procedure
constant tests = {
{"TA", "AAG", "TA", "GAA", "TA"},
{"CATTAGGG", "ATTAG", "GGG", "TA"},
{"AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA"},
{"ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT",
"GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT",
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT",
"GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC",
"CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT",
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC",
"GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT",
"TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
"TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA"}
}
papply(tests, shortest_common_superstring)</lang>
{{out}}
<pre>
Nucleotide counts for :GAAGTA
 
Base counts: Other:0, A:3, C:0, G:2, T:1, total:6
 
Nucleotide counts for :TAGAAG
 
Base counts: Other:0, A:3, C:0, G:2, T:1, total:6
 
Nucleotide counts for :TAAGAA
 
Base counts: Other:0, A:4, C:0, G:1, T:1, total:6
 
Nucleotide counts for :CATTAGGG
 
Base counts: Other:0, A:2, C:1, G:3, T:2, total:8
 
Nucleotide counts for :AAGAUGGAGCGCAUCGCAAUAAGGA
 
Base counts: Other:3, A:10, C:4, G:8, T:0, total:25
 
Nucleotide counts for :CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA
 
Base counts: Other:0, A:74, C:57, G:75, T:94, total:300
</pre>

Revision as of 14:27, 7 February 2021

Bioinformatics/Global alignment is a draft programming task. It is not yet considered ready to be promoted as a complete task, for reasons that should be found in its talk page.

Global alignment is designed to search for highly similar regions in two or more DNA sequences, where the sequences appear in the same order and orientation, fitting the sequences in as pieces in a puzzle.

Current DNA sequencers find the sequence for multiple small segments of DNA which have mostly randomly formed by splitting a much larger DNA molecule into shorter segments. When re-assembling such segments of DNA sequences into a larger sequence to form, for example, the DNA coding for the relevant gene, the overlaps between multiple shorter sequences are commonly used to decide how the longer sequence is to be assembled. For example, "AAGATGGA", GGAGCGCATC", and "ATCGCAATAAGGA" can be assembled into the sequence "AAGATGGAGCGCATCGCAATAAGGA" by noting that "GGA" is at the tail of the first string and head of the second string and "ATC" likewise is at the tail of the second and head of the third string.

When looking for the best global alignment in the output strings produced by DNA sequences, there are typically a large number of such overlaps among a large number of sequences. In such a case, the ordering that results in the shortest common superstring is generrally preferred.

Finding such a supersequence is an NP-hard problem, and many algorithms have been proposed to shorten calculations, especially when many very long sequences are matched.

The shortest common superstring as used in bioinfomatics here differs from the string task Shortest_common_supersequence. In that task, a supersequence may have other characters interposed as long as the characters of each subsequence appear in order, so that (abcbdab, abdcaba) -> abdcabdab. In this task, (abcbdab, abdcaba) -> abcbdabdcaba.


Task
  •   Given N non-identical strings of characters A, C, G, and T representing N DNA sequences, find the shortest DNA sequence containing all N sequences.
  •   Handle cases where two sequences are identical or one sequence is entirely contained in another.
  •   Print the resulting sequence along with its size (its base count) and a count of each base in the sequence.
  •   Find the shortest common superstring for the following four examples:
 
("TA", "AAG", "TA", "GAA", "TA")
("CATTAGGG", "ATTAG", "GGG", "TA")
("AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA")
("ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT",
"GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT",
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT",
"GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC",
"CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT",
"TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC",
"GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT",
"TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC",
"CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA",
"TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA")
Related tasks




Julia

<lang julia>using Combinatorics

""" Given a DNA sequence, report the sequence, length and base counts""" function printcounts(seq)

   bases = [['A', 0], ['C', 0], ['G', 0], ['T', 0]]
   for c in seq, base in bases
       if c == base[1]
           base[2] += 1
       end
   end
   println("\nNucleotide counts for $seq:\n")
   for base in bases
       println(lpad(base[1], 10), lpad(string(base[2]), 12))
   end
   println(lpad("Other", 10), lpad(string(length(seq) - sum(x[2] for x in bases)), 12))
   println("     _________________\n", lpad("Total length", 14), lpad(string(length(seq)), 8))

end

"""Return the position in s1 of the start of overlap of tail of string s1 with head of string s2""" function headtailoverlap(s1, s2, minimumoverlap=1)

   start = 1
   while true
       range = findnext(s2[1:minimumoverlap], s1, start)
       range == nothing && return 0
       start = range.start
       startswith(s2, s1[start:end]) && return length(s1) - start + 1
       start += 1
   end

end

"""Remove duplicates and strings contained within a larger string from vector of strings""" function deduplicate(svect)

   filtered = empty(svect)
   arr = unique(svect)
   for (i, s1) in enumerate(arr)
       any(p -> p[1] != i && occursin(s1, p[2]), enumerate(arr)) && continue
       push!(filtered, s1)
   end
   return filtered

end

"""Returns shortest common superstring of a vector of strings""" function shortest_common_superstring(svect)

   ss = deduplicate(svect)
   shortestsuper = prod(ss)
   for perm in permutations(ss)
       sup = first(perm)
       for i in 1:length(ss)-1
           overlap_position = headtailoverlap(perm[i], perm[i+1], 1)
           sup *= perm[i + 1][overlap_position+1:end]
       end
       if length(sup) < length(shortestsuper)
           shortestsuper = sup
       end
   end
   return shortestsuper

end

testsequences = [ ["TA", "AAG", "TA", "GAA", "TA"], ["CATTAGGG", "ATTAG", "GGG", "TA"], ["AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA"], ["ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT", "GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT", "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA", "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC", "AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT", "GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC", "CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT", "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC", "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC", "GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT", "TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC", "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA", "TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA"] ]

for test in testsequences

   scs = shortest_common_superstring(test)
   printcounts(scs)

end

</lang>

Output:
Nucleotide counts for TAAGAA:

         A           4
         C           0
         G           1
         T           1
     Other           0
     _________________
  Total length       6

Nucleotide counts for CATTAGGG:

         A           2
         C           1
         G           3
         T           2
     Other           0
     _________________
  Total length       8

Nucleotide counts for AAGAUGGAGCGCAUCGCAAUAAGGA:

         A          10
         C           4
         G           8
         T           0
     Other           3
     _________________
  Total length      25

Nucleotide counts for CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA:

         A          74
         C          57
         G          75
         T          94
     Other           0
     _________________
  Total length     300

Phix

<lang Phix>requires("0.8.4") -- (or the trivial 7/2/21 bugfix in punique.e)

procedure printcounts(sequence ss) -- Given DNA sequence(s), report the sequence, length and base counts

   for i=1 to length(ss) do
       string dna = ss[i]
       sequence acgt = repeat(0,6)
       for j=1 to length(dna) do
           acgt[find(dna[j],"ACGT")+1] += 1
       end for
       acgt[$] = sum(acgt)
       string ncf = "Nucleotide counts for :"
       printf(1,"%s%s\n",{ncf,join(split_by(dna,50),"\n"&repeat(' ',length(ncf)))})
       printf(1,"\nBase counts: Other:%d, A:%d, C:%d, G:%d, T:%d, total:%d\n\n",acgt)
   end for

end procedure

function deduplicate(sequence ss) -- Remove duplicates and strings contained within a larger string from vector of strings

   sequence filtered = {}
   for i=1 to length(ss) do
       string si = ss[i]
       bool found = false
       for j=1 to length(ss) do
           if i!=j and match(si,ss[j]) then
               found = true
               exit
           end if
       end for
       if not found then
           filtered = append(filtered, si)
       end if
   end for
   return filtered

end function

procedure shortest_common_superstring(sequence ss) -- Returns shortest common superstring of a vector of strings

   ss = deduplicate(unique(ss,"STABLE"))
   sequence shortestsuper = {join(ss,"")}
   integer shortest = length(shortestsuper[1])
   for p=1 to factorial(length(ss)) do
       sequence perm = permute(p,ss)
       string sup = perm[1]
       for i=2 to length(perm) do
           string pi = perm[i]
           for j=-min(length(pi),length(sup)) to 0 do
               string overlap = sup[j..$]
               if overlap = pi[1..length(overlap)] then
                   sup &= pi[length(overlap)+1..$]
                   pi = ""
                   exit
               end if
           end for
           if length(pi) then ?9/0 end if -- (sanity chk)
       end for
       if length(sup) < shortest then
           shortest = length(sup)
           shortestsuper = {sup}
       elsif length(sup) = shortest
         and not find(sup,shortestsuper) then
           shortestsuper = append(shortestsuper,sup)
       end if
   end for
   printcounts(shortestsuper)

end procedure

constant tests = { {"TA", "AAG", "TA", "GAA", "TA"}, {"CATTAGGG", "ATTAG", "GGG", "TA"}, {"AAGAUGGA", "GGAGCGCAUC", "AUCGCAAUAAGGA"}, {"ATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTAT", "GGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGT", "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA", "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC", "AACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT", "GCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTC", "CGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTCT", "TGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC", "CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGC", "GATGGAGCGCATCGAACGCAATAAGGATCATTTGATGGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATT", "TTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATC", "CTATGTTCTTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA", "TCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGA"} } papply(tests, shortest_common_superstring)</lang>

Output:
Nucleotide counts for :GAAGTA

Base counts: Other:0, A:3, C:0, G:2, T:1, total:6

Nucleotide counts for :TAGAAG

Base counts: Other:0, A:3, C:0, G:2, T:1, total:6

Nucleotide counts for :TAAGAA

Base counts: Other:0, A:4, C:0, G:1, T:1, total:6

Nucleotide counts for :CATTAGGG

Base counts: Other:0, A:2, C:1, G:3, T:2, total:8

Nucleotide counts for :AAGAUGGAGCGCAUCGCAAUAAGGA

Base counts: Other:3, A:10, C:4, G:8, T:0, total:25

Nucleotide counts for :CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATG
                       CTCGTGCTTTCCAATTATGTAAGCGTTCCGAGACGGGGTGGTCGATTCTG
                       AGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGAT
                       GGGACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTT
                       CGATTCTGCTTATAACACTATGTTCTTATGAAATGGATGTTCTGAGTTGG
                       TCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTATA

Base counts: Other:0, A:74, C:57, G:75, T:94, total:300